Animal of the Week

Animal of the week rehoused

2010-11-15T06:02:00.002Z

Dear Followers, of which I have few, AOTW is to rise phoenix like -- or Worcester's buttonquail-like -- from obscurity. But I have rehoused the blog.

All archived and new animals are available here: http://aotwanimaloftheweek.blogspot.com/

Also, I will tweet! @animaloftheweek

Animal of the Week -- May 29, 2009

2009-05-29T11:27:00.000+01:00

Well, it's been a while, but I can't resist reintroducing Animal of the Week on this auspicious day. For yes, today, May 29, 2009, European beavers (Castor fiber) are once again, after an absence of 400 years, living wild in the UK. A momentous occasion indeed.

Or is it? Contained beaver releases have been done on several sites in the UK, and rumours abound of illegal releases in Scotland over the past few years. This official trial of beaver reintroduction in the remote and wild Knapdale forest will determine whether Scottish authorities will spread beavers more widely over the country. English and Welsh authorities are both investigating the potential for bringing back beavers.

It's been quite a while since I have been near a beaver, and much as I am excited by the prospect of encountering the world's second largest rodent wild in the UK, I can't help but think their reintroduction is a bit of a folly. With no natural predators in the UK, and the likelihood of wolves, bears, or lynxes being brought back slim at best, if the reintroduction is a success the country could soon be overrun with beavers. Perhaps people could turn to them as a source of food to combat their spread, as some have with grey squirrels, the great rodent invader of the UK. But really, squirrel I could probably manage, but I'm not sure how I feel about eating beaver.

What?!

Animal of the Week -- April 6, 2009

2009-04-06T20:59:00.000+01:00

Good-day to you all,

Imagine an earthworm, colour it brown-grey with a little iridescence. Add to each of its segments, on either side (as much as a cylinder has sides), a fleshy appendage, part tentacle, part leg. Surround each appendage with bristles. To the simple opening that is the mouth of your earthworm add sensory tentacles and wide snapping pincer-like jaws. Sounds pretty gross right? .... Now, scale it up to over a metre in length. Hold that thought. Now imagine you work in a provincial aquarium where mysteriously coral has been being devoured in your reef tank, and fish in that display have been found with large chunks missing from them. You can't for the life of you work out what is causing the damage, so gradually, piece by piece, you dismantle the display. One evening, on lifting up a lump of coral, the giant worm leaps out at you -- mouth tentacles flailing, mucus dripping from its snapping jaws, fleshy appendages undulating.

Argh!

Thank your lucky stars you've got a sofa to hide behind, because the hapless workers at Newquay's Blue Reef Aquarium had no such comfort when they found the 4 ft long polychaete worm, which they have since nicknamed Barry.

Polychaetes are a huge class of animals of more than 10 000 species, including free-living predators, tiny zooplankton, sedentary tube worms, and fan worms. So, I don't hold out too much hope that I should accurately identify the species in question here. However, a little online research shows that the size and habits of Barry match worms of the genus Eunice. Searching further -- the new google autocomplete function trying to direct me to Gladiators star of the 1990s, Eunice Huthart -- it seems that a very likely species is Eunice aphroditois (Bobbit worm).

Bobbit worms are large omnivorous polychaetes that inhabit pacific coral reefs. For the most part they graze on algae, but they are not averse to munching on a little coral from time to time, and their lightning quick speed enables them to also make fast food out of swimming crustaceans and fish (http://www.youtube.com/watch?v=tkUSx6aQGXU). Barry is typical size of a large Bobbit worm, although they reportedly reach 3 m in length.

The species common name is after Lorena Bobbit, famed for dismembering her husband John Wayne Bobbit. After mating, the female worms often use their lightning attack to bite off and devour their mates' private parts. You might think the allusion to Aphrodite, Greek goddess of love, in the species name something of an odd choice for a creature that looks and behaves the way of a Dr Who monster. However, one of the stories of Aphrodite's origin is that Gaia, sick of Uranus imprisoning the children she had with him, gave her son Cronos a sickle and ordered him to seek revenge by castrating his father. Dutifully Cronos carried out his mother's wishes and threw his father's parts into the sea, from the discarded tackle grew beautiful Aphrodite who was born to shore on briny foam, or perhaps a clam shell.

Happy easter,

Peter Hayward
Head Keeper
Animal of the Week

Animal of the Week -- March 30, 2009

2009-03-30T07:30:00.001+01:00

So yeah, I realise that over the past two years I have been about as regular as a Russian gymnast. I guess since I last sent one out you'll all have new jobs and new emails and won't get this. I know I have, and won't.

Anyway, I am going to plough on, but as I try to revive this whole animal of the week thing -- bringing it back from the brink of extinction by transplanting the DNA from hair follicle found stuck to a bottle of gin in my freezer into the nucleus of a closely related blog and hoping that the resulting embryos survive to term -- I'll try to keep this brief.

For one reason or another this Sunday, I missed Yellowstone, the BBC series about the world's first national park, but when I got home that evening I went straight to the iPlayer thinking I would find it there. But on the front page of said tool was an invitation I couldn't resist. Fish! A Japanese Love Story. Part of BBC4's Japan season, this hour and a half documentary followed a British angler exploring the Japanese passion for fish. From a flayed snapper flapping on a plate of its own sushi, to koi carp worth millions and a whale barbecue, the show was a real delight -- if somewhat gruesome.

One of the most highly prized food fish in Japan is this weeks animal of the week, Takifugu rubripes (fugu, Japanese pufferfish). So highly poisonous that, like his forefathers into the mists of time, Emperor Akihito is not allowed to eat it lest he succumb, the flesh of fugu can only be prepared by licensed sushi chefs, and several people every year die from having eaten poorly prepared fugu. Assimilating neurotoxins from bacteria in the animals it eats, the livers and ovaries of these fish, if eaten, leave the victim completely conscious but totally paralysed until he or she dies of asphyxiation -- the toxin is several times more potent than cyanide. But the small amounts of the toxin found in the skin and flesh of the fish produce a pleasant numbness when eaten.

Farmed fugu that are completely non-toxic, are now available, although the Japanese Fugu Association apparently still bans the consumption of their livers, and the emperor has yet to taste. Fugu are a model organism in genetics with their genomes having been entirely sequenced. For some reason, fugu lack much extraneous genetic material and have about the bare minimum DNA for a vertebrate to function.

Be warned that various bits of the excellent BBC documentary (http://www.bbc.co.uk/iplayer/episode/b00jdw5k/Fish!_A_Japanese_Obsession/) are quite gruesome, especially the sections on preparing snapper and fugu -- while the Japanese clearly love fish, cultural views of the importance of animal welfare vary throughout the world. Sounds a bit too much for you to stomach? Whenever I think of fugu, I think of the episode of the Simpsons in which Homer eats some and is convinced he will die; the restaurant in which he eats the fugu naturally has a karaoke bar, in which Bart and Lisa do an excellent rendition of the Theme From Shaft (http://www.youtube.com/watch?v=MPTyLnVcsL4).

I thought I was keeping it brief? Oh!

Peter Hayward
Head Keeper
Animal of the Week

Animal of the Week -- February 2, 2009

2009-02-02T22:52:00.000Z

Time for the familiar refrain of "Sorry about the gap"

But January was full of taxes. I have never done my self-assessment tax-return before, so it was all a bit new. But you know what? Moira Stewart and the rest of them may well be right -- taxes don't have to be taxing. They do, however, have to be blindingly tedious. It was like doing revision for GCSEs again, sit down to do it and then drift off into a private reverie, try to learn Yankee-Doodle on an out of tune ukelele, wash-up, eat, wash-up, eat, go out for dinner -- anthing to avoid the tax and largely avoid looking at a computer screen. All I seem to have thought about for the past month is tax: the fact that I had to do my tax return, the fact that I had not yet done my tax return, the fact that when actually sat at the computer "doing my tax return" I was spending more time reading the individual wikipedia pages on ancient Hollyoaks characters than I was doing my tax. Tax tax tax tax TAX. So here I am, a stone heavier and a hefty wedge of my bank account lighter.

Anyway, the walk (or more appropriately skate) to work this morning, dodging the falling penguins and musk ox on the way to Kennington station, inspired me to finally put the nightmare of tax behind me and get back on track with AOTW. So, without a further thought for tax and the tediousness of January, and the tax bill I just paid so that all public infrastructure can grind to a halt with a dusting of snow; no, with no thought of tax, this week's animal is the leech.

Related to earthworms, leeches are a huge group of squidgy worms, renowned for sucking the very lifeblood of humans. Some of them provide useful medical services, but mostly they are just a waste of time and space.

Animal of the Week -- December 22, 2008

2008-12-22T22:50:00.000Z

If you have ever wondered why Santa, living somewhere around the North Pole, didn't turn to huskies to pull his sleigh, or maybe polar bears, or musk ox, all you need to know that all those animals have morbid fear of heights; they'd be no good -- seriously, if you've ever tried to talk a musk ox down a steep flight of stairs, you'll know what I'm talking about. But Dasher, Dancer, Prancer, Vixen, Comet, Cupid, Dunder, and Blixem, aided by a little Christmas magic, merrily take to the sky to distribute presents to all the kiddywinks who have been good throughout the year.

Reindeer, or caribou as they are known in North America, are the archetypal herbivore of the Arctic distributed from Norway to Norway all the way around wherever there is land and a smattering of lichen. With their large noses for warming ingoing air and collecting precious water from exhaled air, their thick double coats that are so well insulated the animals can lie on snow without causing it to melt, and their feet that change with the season to provide traction on ice in the winter and mud in the summer, no animals could be better suited to the snow spangled taiga forest of Siberia or the open frozen tundra of Canada.

Throughout Eurasia, native peoples of the high arctic have commonly domesticated, or partly domesticated reindeer, and the appearance of the animals in cave paintings suggests that for millenia reindeer have been important to humans as a source of food and materials for clothing and food. Now, only a few truly wild populations remain in Europe, but huge wild herds remain in Canada and the US. Across their range there are various subspecies: the small Svalbard reindeer (R. tarandus platyrhynchus), European wild reindeer (R. tarandus fennicus), and the porcupine caribou (R. tarandus granti). Perhaps the best known subspecies is R. tarandus rufinostris.

Reindeer mostly eat lichen,but they also browse on shrubs and, in the autumn, they have a particular fondness for mushrooms. Some reindeer herders exploit the deer's love of mushrooms -- after feeding their herds with fly agarics (fat red mushrooms with white spots), the herders drink the reindeers urine which contains hallucinogenic chemicals from the mushroom. Strangely, drinking reindeer wizz makes the herders less sick than would eating the mushrooms themselves. Suddenly, the origins of the idea of a jolly fat man clad in red and white traversing the heavens on a sleigh pulled by flying deer start to become clear.

Merry Chrimble One and All

Animal of the Week -- November 10, 2008

2008-11-10T13:57:00.000Z

"The sea has its large rivers like the continents. They are special currents known by their temperature and their colour. The most remarkable of these is known by the name of the Gulf Stream. Science has decided on the globe the direction of five principal currents: one in the North Atlantic, a second in the South, a third in the North Pacific, a fourth in the South, and a fifth in the southern Indian Ocean. It is even probable that a sixth current existed at one time or another in the northern Indian Ocean, when the Caspian and Aral seas formed but one vast sheet of water."

So mused Professor Aronnax aboard Captain Nemo's Nautilus in Jules Verne's Twenty Thousand Leagues Under the Sea.

It is such rivers that helped this week's animal, Megaleledone setebos become the forebear of many species of deep sea octopus. A study from the Census of Marine Life show that this unassuming octopus of shallow Antarctic waters is the likely forebear for many diverse species of deep-sea octopuses. Researchers believe that ocean currents, such as Professor Aronnax's rivers, carried larvae from the shallow Antarctic waters to the deep sea where, in isolation, and under the new selective pressure (quite literally in the deep oceans) they diverged into separate species. The idea that a living species is the ancestor of others is mighty exciting. It's like stumbling across the last common ancestor of chimps and humans alive [Have you been to Norfolk lately? -- Ed].

The development of these rivers, or thermohaline expressways, is associated with expansion of the ice caps, as fresh water is sequestered in ice caps, concentrated cold salt water sinks helping to create the currents that then flow into the deep oceans -- carrying species from shallower waters with them. Successive periods of activity of these currents related to global warming and cooling create successive waves of immigration to deep sea areas leading to a greater diversity.

As cold waters sink away from the poles, warm waters are pushed and drawn towards them, hence the Gulf Stream keeps the UK and other parts of northwestern Europe, which should be as cold as Canada, ice free. As human-generated global warming melts the ice caps, the Gulf Stream may be disrupted, actually causing temporary cooling of the British Isles and Norway... before we all fry, starve, and die in wars over access to water and Ambre Solaire.

Happy days

Animal of the Week -- October 6, 2008

2008-10-06T18:52:00.000+01:00

As I am sure that you are all aware, in the UK Red Squirrel Week started on October 4. And during this period we are all asked keep in mind the much beleagured European Red Squirrel. And so, in honour of Red Squirrel Week, although totally without ties or affiliation, this week's animal is Scuirus vulgaris.

It's may not be a coincidence that almost three years ago to the day animal of the week recognised the crazy crack squirrels of Lambeth— which, judging by the erratic behaviour of one that leapt onto my friend Talha while walking through Elephant and Castle the other week, have now spread to Southwark. But those were the eastern grey squirrels, invaders from the USA that have outcompeted the native red squirrel and spread diseases that have pushed our reds to the fringes of their former range. During Red Squirrel Week, we are asked to report sightings of red squirrels, particularly any ill looking ones that might have caught squirrel pox from their grey usurpers to help gain a better picture of the extent of the species and the extent of the disease. Your best chances of spotting reds in the UK are around Poole Harbour, the Isle of Wight, Anglesey, Cumbria, Northumberland and Scotland.

Outside the UK the red squirrel is still quite common, grey squirrels having failed to make it to continental Europe (although in Piedmont, Italy, a population of greys has become established and is squeezing the reds from their former range). Greys outcompete reds because they are larger and able to exploit more foodstuffs than the reds -- such as acorns, which give the native reds bellyache.

Confusingly, grey squirrels can appear quite red, and red squirrels come in a variety for shades, from auburn to black, from ginger to, er, grey. If you see a red-tinted squirrel throughout most of the UK, not in the areas above, it is probably a grey squirrel and certainly not, as has been suggested to me before, the result of cross-breeding between the two species. If you see a red squirrel in North America, it will be an unrelated North American red squirrel. The best way to spot a European red is to look for the ear tufts, these little fluffies have prominent squirrel nutkin tufts; whereas greys and other reds do not.

In norse mythology Ratatoskr is a squirrel who runs up and down the World Tree (from which the nine planes of existences hang), spreading news, rumours, and gossip, and ferrying isults between the eagle in Asgard atop the highest branches and the dragon curled up in Hel beneath its roots.

Many thanks,

Peter Hayward
Head Keeper
Animal of the Week

Animal of the Week -- September 15, 2008

2008-09-09T18:56:00.001+01:00

Wherever you look in the news this week, one thing is for sure: ants are where it's at.

First off the news that a blind, subterranean species of ant with huge mandibles discovered in the Amazon a couple of years ago represents a whole new ant subfamily, provides unique insights into the origins of ants. Ants arose from wasps, but perhaps all living ants are descended from ancestors that once lived underground permanently. So weird is this ant that it's name, Martialis heureka, suggests that it might have come from the planet Mars (Martialis). The huereka presumably harking back to the Archimedean cry of scientific enlightenment. Taxonomists are crazy!

By contrast, this week's actual animal of the week is an example of totally uninspired taxonomy: Formica rufibarbis. Now, you may well think that this is a cocktail of downers mixed on a 1970s composite plastic worksurface, but it's actually the red (rufi) barbed (barbis) ant (Formica -- the most familiar ant genus). The naming of this ant is totally lazy, it is indeed, a bit red and what's more it has little barbs on its back... and it's an ant. Taxonomists are, most of the time, boring! But for all that laziness, there is currently a great effort to save this ant from extinction in the UK.

Although widely distributed, the red-barbed ant is never common within it's range from Portugal to Siberia, and in the UK, its highly picky living requirements mean that it can only be found on St Martin's in the Scilly Isles (and why not, that's nice enough) and Chobham in Surrey -- presumably moved there for the schools. However, the mainland population has declined so much that only one colony remained, and due to a reproductive quirk of the species that only produced females. Now the Zoological Society of London and partners are reintroducing captive bred nests, some of males, some of females, onto heathland in Surrey.

The ants have fared poorly in the UK due to habitat destruction. To ease the tranisition for the captive bred ants great effort has gone, not only to preparing suitable habitat for them, but into trying to remove one of their main enemies in the natural world -- Formica sanguinea. This latter ant steels larvae from other colonies and raises them (ahhhhh, that sounds alright -- sort of like Madonna or Angelina Jolie) but then makes the matured ants do all their work for them! As the red barbed ants are released on Chobham downs on Monday, I wish them all the success in the world and salute the work of the tireless souls who work to ensure their continued presence on this sceptered isle.

Animal of the Week -- August 18, 2008

2008-08-18T19:00:00.001+01:00

Look! What's that over there in the bushes? Pass the me the binoculars will you. OH MY GOD! It's a lesser spotter Animal of the week.

It's all been crazy talk of bigfoot and chupacabras from the states recently -- but predictably they turn out to be a monkey suit in a block of ice and a manky old dog. So, I am going for something totally unsensationalist.

If you were to ask me what my favourite animal was, I'd be hard pushed to come up with an answer -- I mean there are bloody loads of them. Would it be a majestic lion, or a honey-making bee? The vanishingly rare Vancouver Island Marmot, perhaps? Maybe it's a fluffy viscacha, or the parasitic carandiru that swims up people in the Amazon? Or a barnacle that replaces the body of a crab in while the crab is alive? There is so much fluffy-cute, crazy-arsed weird-shizzle going down in kingdom animalia that really I wouldn't know where to start picking a favourite. But then, maybe, just maybe...

While visiting my ma's recently to catsit while she took a holiday, I was gazing out over the patio when I noticed a commotion in the hedgerow -- 20 or so tiny black dots fizzing around from tree to tree, and I suddenly felt full of joy and realised that nothing warms the cockles of my heart as much as a flock of this week's Animal Aegithalos caudatus (long-tailed tits).

These birds are small about 8 cm long, more than half of which is their tail, they are fairly common throughout Europe and western Asia, and they are not endangered, particularly useful to people, or really in any way remarkable. But there is something about these tiny balls of feathery fluff, as they swarm over individual bushes, their black and white bodies flecked with pink bars on their wing, swapping places, following one another, emitting shrill, almost supersonic, three-note chirping calls, picking off small insects from among the bark and leaves. They are like tiny clowns -- but nice clowns, not fright-wigged, red-lipped, custard-in-the-pants, It clowns. Just following the path of a flock of these little tits down a hedgerow, or across a scrubby heath, or through a stand of trees in an inner city park or cemetery is one of life's great joys.

Also, now as we head into late summer, while you are out blackberrying, if you spot in some dense scrub a small round ball of moss, feathers, and lint stuck together with spiderwebs, you have probably found a long-tailed tits nest, incredibly well camouflaged and hidden, they are not uncommon but they are hard to spot.

So keep your eyes and ears peeled, if you see little round birds with long tails bubbling through a hedge, singing a high pitched song, take a few minutes to enjoy these charming little tits.

Animal of the Week -- July 28, 2008

2008-07-28T19:04:00.001+01:00

I suppose that the name "Animal of the Week" doesn't necessarily imply there has to be an animal every week, just that when there is one, that's the animal of that week. And a week is pretty much undefined, there's the strict Monday to Sunday concept, but then any group of seven adjacent days is also a week. So the animal of this week is Ptilocercus lowii (pen-tail tree shrew).

Now, as someone who is not averse to the odd jar myself -- I was impressed to read in the newspapers earlier this week that these diminutive distant relatives also actively seek out alcohol and drink enough to be drunk 36% of the time. In the forests of Thailand and Malaysia they are to be found supping on fermented nectar from the flowers of bertam palms. However, the reasearch, published in the Proceedings of the National Academy of Sciences USA shows that rather than get drunk, the alcohol is disposed of in the tree shrews' hair as a chemical that is also found in the hair of humans with chronic alcoholism [those that have hair, eh? -- Ed][Shut it you! And who the hell is this ed anyway? -- PH].

Thought to be similar to the last common ancestor of all primates that lived about 55 million years ago, pen tail tree shrews, named for their mostly naked tail fringed with lateral hairs like a quill on the last third, are the only nocturnal tree shrews. If disturbed during the day they are sluggish, responding by rolling on their back, hissing, urinating, and defecating in defence. I think the researchers who say these critters aren't affected by the booze had better think again.

Much has been made of their prodigious alcohol consumption -- but it turns out the nectar of the bertam palm is only 0.5–3.8% alcohol. It's hardly a bottle of tanqueray now is it? I'll let them off though, at only 50g, they're definitely not lightweights

Animal of the Week -- July 7, 2008

2008-07-07T19:06:00.001+01:00

After the most recent animal of the week a goodly number of folk contacted me to let me know that they had recently seen silverfish, a surprisingly small number, or zero, of these correspondents felt as well disposed towards the graceful little darlings as I do -- most feeling repulsion, disgust, or even fear.

I suspect that this week's animal might also divide opinion, but I'll probably have one or two more people on my side, as this week's animal is the scourge of one of the biggest causes of animosity among neighbours in modern day towns, villages, and suburbs. Although they are a gift to the producers of TV shows about societal conflict in the form of boundary disputes, a great many people abhor leyland cyprus arbors; but across the land, there is a new friend to those living in the shadow of the much loathed conifers -- Cinara cupressi (cypress aphid).

Probably originating in southeastern Europe, these grey 2–3 mm aphids are now found on every continent but Antarctica where it is warm enough for them to breed. In the UK their numbers are largely kept in check as cold winters kill off large numbers of them. However, due to global warming caused by people reading ridiculous almost-weekly emails about animals and the like, last winter the temperature in the southeast was practically tropical throughout. As a consequence these little beasties survived in large numbers. A couple of months ago they began their onslaught, sucking the sap from leylandii hedges up and down the country. Now, the damaged plants are turning brown, whole section and some complete plants dying.

Obviously, this is pestilent behaviour by the aphids, but the hedges are stupid, so good on them I say. Except for those attacking mazes, the only acceptable use for a leylandii. I love a maze, even though I know how to do them and have to resist the temptation to cheat.

Throughout the summer the aphids reproduce parthenogenetically -- ie, the females spew out identical miniatures of themselves without the involvement of any male aphids. A female may contain another female that is already pregnant with the first female's granddaughter, like an entomological russian doll. As winter approaches males are produced by withholding one of the sex chromosomes from some offspring, these mate with females who then lay eggs which overwinter. I like this about aphids, it's neat.

Next week, I hope there will be an animal and maybe even not an insect.

Until then, stay safe, and look out for dying shrubberies.

Animal of the Week -- June 23, 2008

2008-06-23T16:44:00.000+01:00

It can't possibly have escaped your attention that this week in the UK is National Insect Week -- so naturally I am going to join in the celebrations by nominating an insect as this week's animal. But what to go for? Something gaudy and noticeable, such as the swallowtail butterfly or hummingbird hawk moth, both occasional visitors to these shores? Or maybe our largest insect, the stag beetle, which reaches lengths of up to 7 cm including its antlers? Perhaps a lovely lazy bumble bee, many species of which are in decline all over the UK, or our rarest insect the streaked bombardier beetle, which repels predators by squirting a noxious combination of hydrogen peroxide and hydroquinone that explodes with a noisome smell and a loud pop. Damn it! Perhaps I should do all insects. The most diverse group of organisms on the planet perhaps accounting for 90% of species diversity -- although that might take me some time.

Nah, tell you what, among all the glamorous options, let's celebrate a much maligned species which is one of my favourites, Lepisma saccharina (silverfish). These primitive wingless insects (contrary to some misinformation, not all have wings) have remained largely unchanged for the past 300 million years. I guess they get a bad rep for living among rotting wood and damp places in bathrooms, but really they are just probably eating shampoo residue and other stray starch and cellulose based products such as wallpaper paste, glues, or toast. While they might occasionally start nibbling at the gum holding books together, or in rare times of famine nibble at leather or natural fibres, they're probably not doing much damage to your stuff, they just like damp places... and if your books are damp enough to attract silverfish, you've got damp books anyway.

Most commonly seen fleetingly as they retreat from bright light, nocturnal silverfish glide gracefully with glaucous iridescence, undulating like a minnow across your bathroom floor. I think they are quite beautiful. According to wikipedia, "The reproduction of silverfish is preceded by a "love dance", involving three phases, which may last over half an hour. In the first phase, the male and female stand face to face, their trembling antennae touching, then repeatedly back off and return to this position. In the second phase the male runs away and the female chases him. In the third phase the male and female stand side by side and head-to-tail, with the male vibrating his tail against the female", after which the male deposits a gift of sperm, wrapped in gossamer, which the female picks up. How much of the first bit is true I am not sure, the second bit about the giftwrapped seminal present, however, is true. Although they stop short of a post-coital smoke.

So cut these most ancient but graceful creatures some slack for the remainder of National Insect Week, June 23–29.

Animal of the Week -- June 16, 2008

2008-06-16T16:54:00.001+01:00

Many thanks for all the messages I received during the hiatus; sadly many people contacted me to tell of long distant relatives who had died leaving me a fortune in a foreign country or even of offers whereby I help someone with a simple money transfer of a few million dollars, from which I can take a sizable percentage for my troubles. Well, with money like that coming in I doubt there'd ever be the need for a break in AOTW again, so Bayo Bashan, Moham Bello, Mrs Awa Zoundi et al, I shall be sending you my bank details as soon as I have got this week's (or more correctly, this quarter's) AOTW out of the way.I have said before that I will never do a fictional or mythical animal, despite the temptation to do a phoenix this week (although that might be building up my return a little too much), but this week's animal of the week is.... wait for it.... A UNICORN.

OK, it's not a unicorn, but the story reported in the unpopular press of the London Underground of a one-horned roe deer, nicknamed unicorn, roaming an Italian forest piqued my interest. This genetic aberration is one of the more mundane possible sources of unicorn myths -- although a very likely source of the myth of the Kirin, the one horned beer, er deer, of Japanese myth.My personal favourite contender for the origin of the unicorn in mythology -- which has it origins in Persia and China -- is this week's Animal of the Week, the extinct giant rhinoceros Elasmotherium sibiricus. Two metres tall, six long, covered in fur, and sporting a metre long horn on the centre of it's nose, E sibiricus was the largest of the extinct genus and lived on the steppes of Russia. The latest fossil evidence of the animal comes from about 1 million years ago, but there are some who believe that this animal could have survived into the folk memory of people who lived on or passed through the steppes. There are even some accounts by mediaeval travellers of a giant one horned beast that would run down horsemen, picking the rider from the back of his or her steed, gore them to death, but leave the horse unharmed that some suspect might have been remnany populations of one elasmotherium or another. Although more closely related to rhinos than to horses, elasmotheriums were more equine in many ways as they were adapted to a cursorial existence on the open plains of Asia.

Other putative candidates for the source of unicron myths include oryx (Middle Eastern antelope) and aurochs (wild oxen), both of which, when viewed in profile as they would commonly have been painted or carved in ancient artwork, both appear to have a single horn. Of course, other genetic mishaps among antelope, deer, and goats such as created the unicorn deer are possible, and some travelling circuses and inventive scientists supposedly have created unicorn goats by fusing the horn buds of newborn goats. Poor goats.

But I like the the elasmotherium theory, the elasmotheorem if you will, of unicorn origins.

Animal of the Week -- March 10, 2008

2008-03-10T23:58:00.000Z

Where the hell has the time gone? March is half way over already. But the rapid passing of a few months is nothing for this week's animal of the week Pseudobulweria becki (Beck's petrel), which has been missing, presumed extinct, for the past 80 years.

Petrels are sea birds related to fulmars and albatrosses, collectively known as the tubenoses due to the structure of their nostrils atop their bills. Some petrels are among the most numerous species of sea birds. But not Beck's petrel -- known from two specimens collected in the 1920s, it had not been reliably spotted since 1929. Repeated unconfirmed sitings kept alive the hopes that a population of this species was clinging on in the western Pacific, but the similarity of Beck's and the closely related Tahiti petrel made many ornithologists sceptical of their survival.

Last week, however, Hadoram Shirihai -- an Israeli ornithologist with a rep for discovering new species and the only person to have visited all sub-Antarctic islands to see all the species of albatross -- reported photographing 30 or so birds feeding alongside Tahiti petrels in the Bismark Archipelago northeast of New Guinea. Smaller in size than their companions, he recognised them as the errant Beck's petrel. The group contained adults and juvenile birds, showing that a breeding population is hanging on somewhere in the region. The discoverer of the species, Rollo Beck, suggested that this species bred in low lying atolls in Melanesia. Secretive birds, most petrels return to breeding grounds at night making them especially difficult to track.

Petrels have a habit of hovering above the surface of the sea, their feet just touching the water as they pick off surface dwelling plankton and small fish. This habit is the origin of their name, which is derived from St Peter who was said to have walked on water, his feelings towards plankton, however, are lost to hagiography.

The exciting news about the rediscovery of the Beck's petrel resurrects hope for other missing species such as the Newcastle Brown Whale, the Guiness Black Stoat, the Famous Grouse and the Kronenbourg sixteen-sixty-doormouse.

Sorry!

Animal of the Week -- March 03, 2008

2008-03-03T07:03:00.000Z

Hello All!

I apologise if any of you chaps had nightmares about the snakeheads slithering their way to your doors with the limb-like fins and toothy jaws. I dare say that the majority of you living in the UK had any piscine pursuers shaken from your dreams as you were shaken from your beds. It is a curious coincidence that shortly before Britain's biggest earthquake in nearly 20 years, I was reading a passage in Darwin's peerless journal The Voyage of the Beagle that described an enormous earthquake in Chile. On February 20, 1835, the edge of Chile was shifted nearly a foot upwards by tectonic activity. Fortunately for Darwin, at that time visiting the Chiloe archipelago, he experienced only tremors of the earthquake. Concepcion, the city above the epicentre was utterly ruined when Darwin arrived a few days later, the devestation too harrowing for Darwin to put into words.

Also present on the Chiloe archipelago on February 20, 1835 were representatives of this week's animal of the week Pseudalopex fulvipes (Darwin's fox or Darwin's zorro). This small fox-like dog, dark grey with rufous trim, is related to other South American grey foxes on the mainland, but is proportionately longer in body and shorter in limb. Until the 1970s, the species was thought confined to Chiloe, but a small population was discovered some 600 km away on the mainland, at the other end of the now submerged land bridge that linked Chiloe to the mainland until sea-levels rose at the end of the last ice age.

Darwin's fox is critically endangered with fewer than 100 in the mainland population and around 250–500 on Chiloe. Charles Darwin was the first European scientist to observe the fox, specifically one fox watching curiously the officers of The Beagle work on the ship, at which point he made his own contribution to the endangerment of the canine that would come to bear his name as this, typically dry yet amusing, passage from The Voyage shows:

A fox (Canis fulvipes), of a kind said to be peculiar to the island and very rare in it, and which is a new species, was sitting on the rocks. He was so intently absorbed in watching the work of the officers that I was able, by quietly walking up behind, to knock him on the head with my geological hammer. This fox, more curious or more scientific, but less wise, than the generality of his brethren, is now mounted in the museum of the Zoological Society.

Genius!

Animal of the Week -- February 25, 2008

2008-02-25T06:28:00.003Z

Morning/Afternoon/Evening all,

As the days lengthen and the sun makes itself felt, thoughts might turn to long summer days whiled away on the banks of a river...especially if a friend of your posts photos of your teenage selves enjoying such a halcyon day on Facebook. But how keen would we have been launch ourselves from the overhanging tree into the tubid stream had we suspected the presence of Channa argus (northern snakehead) or C micropeltus (giant snakehead) in the slow-moving muddy-bottomed river?

Last week, a Lincolnshire angler fishing for pike got a surprise when his sprat attracted the attention of a more exotic fresh water predator 60 cm long and with a mouth crammed with nasty sharp pointy teeth. The fish was later identified as a giant snakehead, a voracious predator from southeast Asia. Capable of growing 2 m long, giant snakeheads are valued as sports fish and food fish, but treated with caution as mothers have been known to attack people to protect their young. Snakeheads breath air rather than extract oxygen from water with their gills as most other fish do, and they can survive several days out of water, and rather terrifyingly these toothy monsters can crawl overland from pool to pool, from one water catchment to another. If you are terrified by the idea of a 2 m giant snakehead crawling into your front room in Lincoln, fear not. These fish need warm water to survive, and the one caught in Lincolnshire had likely been released only very recently by a tropical fish enthusiast whose tanks had been outgrown.

Phew! Right? The more attentive of you will note that this week's animal is also the northern snakehead as well as the giant. The former is similar to the latter in size, habits, ferocity, and ability to crawl over land, but what makes it more terrifying for those of us in temperate latitudes, is that, living in northern China and Russia, these fish can very happily survive in colder climes. Already across the USA, northern snakeheads have invaded lakes and rivers, wreaking destruction to fisheries and wildlife in their wake. One population in Maryland was thought to have become established after a man purchased a pair from a Chinese food shop to make his sick sister a traditional remedy.

Fortunately for us Europeans, trade in these leviathans is banned for both aquarists and enthusiasts of Chinese gastronomic remedies. So we are protected from the northerns for now... but what if that giant snakehead wasn't a recent escapee, it's been a mild winter after all, and what with global warming, perhaps they are breeding in the UK!! Perhaps there's a giant snakehead slithering to your door right now!!!

Thank god I live on the third floor; although I may have to rethink my summer swims in Hampstead ponds. Dammit!

Animal of the Week -- January 11, 2008

2008-02-11T22:44:00.001Z

Hello and apologies for slackness,

I so enjoyed the mole the other week that I wanted to give it plenty of time to be AOTW... or I just spent the last week drunk... one of the two, let's go with the mole story.

This week's animal of the week is kind of one animal used as a representative of a whole species. For this week's animal of the week is Electra the golden eagle who has become the first eagle recipient of successful cataract removal. Golden eagles (Aquila chriseatos) are widely regarded as some of the best hunters among the birds of prey. Soaring high over highlands and wild spaces across the entire northern hemisphere from Kamchatka to Kinross in either direction, they are able to spot a mountain hair loping through the furze from two miles away.

Electra of Greek myth was complicit in the murder of her mother Clytemnestra and step father Aegisthus to avenge their murder of her father Agamemnon. Electra the eagle was named after her failure to spot -- eagle eyed indeed -- an electricity pylon in Mull. The collision resulted in severe burns. Apparently the eagle's slack judgement was not due to already poor eyesight but actually caused the traumatic cataracts, leaving poor Electra as blind as a bat -- though presumably not as blind as a spectacled bat (Pteropus conspicillatus).

Fortunately Electra was rescued and taken to Wings Over Mull, a centre for sick and injured birds in the highlands and islands. Staff noticed Electra's problem sight and ordered the first ever operation to remove cataracts from a golden Eagle. A short surgery later and Electra now has good eyesight in one eye. Though not a clean bill of health, because her eyesight is not fully recovered in both eyes she will not be able to return to the wild, but she has been housed with a male golden eagle with a broken wing.

Such pioneering operations offer hope for other animals with poor eyesight: such as the spectacled bear, the monocled fox, and the astigmatism weevil (some or none of which may be fictional).

On January 30th, the day I eventually sent the last animal of the week, by pure coincidence, the rare genius that is Howard Hardiman did a mole in his excellent when pigeons weep web cartoon series, Do have a browse, but be warned, some of the entries are a little, er, racey.

All the best!

Animal of the Week -- January 28, 2008

2008-01-28T07:05:00.000Z

Hello Ani-freaks!

Go see a wonderful post-it comic featuring animals (and other things) called When Pigeons Weep, on Jan 16 there is a troglobyte!

This week's animal of the week is a bane of the lives those two guardian-occupations of the UK landscape: farmers and gardeners. Although these two groups of people are renowned for their compassion and tolerance towards wildlife, nothing gets their backs up so much as this week's animal Talpa europaea (European mole) -- well, except maybe mice, rats, mealy bugs, birds of prey, slugs, deer, pigeons, badgers, rooks, aphids, pheasants, cats, and vine weevils. And foxes.

Their habit of digging extensive underground tunnels terminating in small mounds of earth has pitted moles the world over against lawn-proud gardeners. But actually the moles' toils not only aerate and break up soil, but their prodigious consumption of leatherjackets and other pests of crops and garden plants are actually a benefit to people who work the land. And while they may eat those other great processors of soil, earthworms, they cannot consume enough to affect the latter's benefit to gardeners and farmers.

Immortalised in Kenneth Grahame's Wind in the Willows as home-loving, timid fellows, moles may be nearly blind but they are voracious predators, consuming nearly two-thirds their own body weight a day in grubs and worms. They have toxic saliva that paralyses their invertebrate prey enabling them to build up a larder for lean times. It was a pondering about the nature of toxic mammals that started animal of the week some3 and a bit years ago, turns out loads of insectivorous mammals have toxic saliva.

Among all the crocodiles, mosquitoes, tigers, sharks, tyrannosaurs, and snakes that have been animal of the week, European moles are only the second to be blamed for the death of an English king. William III, of Orange, was out riding in the early 18th century when his horse trod in a mole tunnel and threw its rider. The resulting broken collarbone led to pneumonia (ED: can that happen? PH: ED, who is ED?), and the pneumonia led to the accession of Queen Anne, prior to which the Jacobites, hoping to seize the opportunity to reinstate a Scottish monarch, were commonly heard to toast "the little man in his velvet jacket". The other regicidal AOTW is, of course, the lamprey

Want to help people find out about moles? Join the People's Trust for Endangered Species in their MOLEWATCH. Report sighting of moles or more likely molehills here: http://www.ptes.org/molewatch/. Though not endangered, changing land use and increasing floods may threaten moles. When I was a kiddywink on the farm, if the river flooded the moles would gather on the small patches of unsubmerged ground, the dogs -- Goldie, Shelly, and Bella -- would like nothing more than unearthing the stranded moles. The carnage was a horrific sight. I am sorry moles. I couldn't stop it!

All the best!

Animal of the Week -- January 21, 2008

2008-01-22T14:23:00.000Z

Word!

I am again amazed by the early appearance of a harbinger of spring, but I fear that I bang on about this every year, so I'll skirt around the issue by not mentioning the full name of the animal -- despite it being mid January, I saw five or six "Bs" this weekend just gone! But anyway, this sign of climate change has nothing to do with this week's animal of the week, or does it? This week's animal is Boulengerula niedeni (the Sagalla caecilian).

This limbless animal has been picked as one of ten amphibians to be the focus of conservation efforts in the next wave of the EDGE (Evolutionarily Distinct & Globally Endangered) programme, which is run by the Zoological Society of London to protect the most vulnerable and evolutionary isolated animals, drawing attention to some of the less glamorous species. Caecilians may look like earthworms, but they are actually a highly specialised offshoot of the amphibian family tree inhabiting the leaf litter and top soil of equatorial forests.

Sagalla caecilians are found in a 30 km square region of southern Kenya, and while they might be quite numerous in that small area, being found nowhere else, they are incredibly sensitive to changes in or degradation of that environment. In a marvellous coincidence with last week's animal, Sagalla caecilians have tentacles beneath their eyes, or rather below where their eyes should be, for they, like many other caecilians are blind. A close relative of the Sagalla caecilian, Boulengerula taitanus, has a bizarre maternal habit -- females brooding a clutch of eggs develop a thick layer of skin on which the young, unable to eat other foods, nourish themselves without apparent detriment to their mother's wellbeing.

Turns out AOTW has featured EDGE species since the start, the first edition was one of their highlighted mammals, the solenodon (http://animal-of-the-week.blogspot.com/2004/10/animal-of-week-october-25-2004-first.html), and several others flop, slither or flounder around my backfiles in the webzoo (the baiji http://animal-of-the-week.blogspot.com/2004/10/animal-of-week-october-25-2004-first.html; and the giant salamander http://animal-of-the-week.blogspot.com/2005/05/animal-of-week-may-30-2005-giant.html).

Let's just hope that the Sagalla caecilian fares better than the baiji, which is now presumed extinct. I suppose this amphibian has family on its side. You don't want to mess with caecilians, you do and you'll wake up with a horse's head in your bed.

Animal of the Week -- January 21, 2008

2008-01-21T08:55:00.000Z

Animal of the Week -- January 14, 2008

2008-01-14T07:17:00.000Z

Good morrow good women and gentlefolk,

It was a most pleasing moment last week when a colleague forwarded me a link to a news story, not about a pair of twins getting married (http://news.bbc.co.uk/1/hi/uk/7182817.stm), but about a Pacific giant octopus playing with a Mr Potato head (http://news.bbc.co.uk/1/hi/england/cornwall/7179368.stm). The giant mollusc loves his toy, mostly because it's got crab meat inside it (which is a feature I don't recall from the Mr Potato Head that I had), but also its bright colours and moving parts. Now, as you might guess, the Pacific giant octopus (Enteroctopus dofleini) is a big octopus, reports of a 272 kg, 9 m, specimen are highly doubtful, but a 71 kg live specimen is confirmed. But it turns out that this size record is rivalled among the octopodes by a bizarre freak of the molluscan world -- this week's animal of the week is Haliphron atlanticus (the seven-arm octopus). Of which a dead specimen weighed in at 61 kg, giving an estimated live weight of 75 kg, and had a mantle length (the head-like bit) of 40 cm.

What? I hear you cry. How can there be such a thing? Surely this septapode octopus is a contradiction in terms, and cephalopod oxymoron, a lie, a fabrication, a genetic freak or frankenstein fish. No, I tell you, it is real, a proper species.

The truth is that the distaff representatives of the species have the full complement of octopus legs; but once more, in the face of all we expect to be true about the natural world, the males are missing a limb. In octopuses (please, not octopi) and other cephalopods (squids, cuttlefish, and nautili), the males have a specially adapted limb, the hectocotylus, which is used to deliver sperm to the female. In many other octopuses this arm is larger than the others, but in the seven-arm octopus, this sperm arm is small and coiled up in a small pouch underneath the right eye. During the act, the male unfurls his arm from beneath his eye and makes a special delivery to a cavity under the female's gelatinous mantle. So I guess, "giving her the eye", means something much more intimate in octopus courtship than in human relations.

Bye then!

Peter Hayward
Head Keeper
Animal of the Week

Animal of the Week -- December 31, 2007

2007-12-31T14:51:00.000Z

Happy gnu deer!

It seems only right that I should ring in 2008 with at least a passing reference to the new species of giant rat and ungiant opossum discovered in the Foja mountains of Indonesia's Western Papua province a couple of weeks back. But there was a slew of marsupial AOTW in may, and you'll already know all about that giant rat, Mallomys -- unafraid of humans, five times the size of a city rat, closely related to several other species of giant rat found on the same island -- so why bother with Mallomys when there are other gianter rats, twice the size, that save human lives.

This week's animal is the 3 kg Cricetomys gambianus (Gambian pouch rat). Distributed across sub-Saharan Africa, from Nigeria to Zululand, these animals take their name from the Gambia where some of them live, the cheek pouches that allow them to transport fruit, seeds, and other foods, and from their rattiness. Although they are not actually that closely related to Norwegian or black rats with which you may be more familiar if you haven't spent substantial time in Africa.

You can distinguish Gambian pouch rats from their close relatives, Emin's pouch rats, not by their ability to make a bed or their sobriety on TV, but by their coarser brown fur and their single-note squeal which contrast with the latter's silky grey fur and multi-pitch squeaking (presumably the link to Emin).

Able to have nine litters a year, these animals occasionally reach pest proportions in some towns and agricultural land where they can destroy crops. The rats have no natural predators, because, while the occasional one might be eaten by opportunist snakes, cats, dogs, eagles, and mongooses, these giant rats, when threatened, band together and rear up on their hind legs to see off aggressors.

If you are feeling uneasy about the prospect of bands of bipedal squealing giant rats, don't worry. Humans have the upper hand, both species of pouched rat are highly regarded as food in much of their range. More pleasingly though, these animals are increasingly kept as pets. Humans have also begun to exploit the rats' excellent sense of smell, in Mozambique they have been trained to sniff out undetonated landmines, and even more implausibly they are now being trained to diagnose tuberculosis by smelling saliva samples. No, really, they can get through hundreds of samples in much less time than humans using conventional diagnostics and they are much cheaper, more portable, and less likely to go wrong in tropical Africa than other tests.

What wonderful rats!

Animal of the Week -- December 17/24, 2007

2007-12-17T21:49:00.000Z

You know, sometimes, when the pressure is on, I get performance anxiety and and I just can't deliver? And I am also sorry that I missed Animal of the Week last week.

I've done—in the sense of having covered them in Animal of the Week—turkeys, donkeys, and, of course, in last year's special, 364 animals (http://animal-of-the-week.blogspot.com/2006/12/animal-of-week-december-1825-2006-deep.html), so what is there left for me to do at this time of year? What festive animals are left—the chuckwallah, the mangabey, the roadrunner? Well no, this week I bring you, dear reader, a gift of the animals that bore the Magi with their presents into The Gospel of Matthew, Camelus dromedarius (dromedary, one humped camel)

If you were a wise man from the east looking for a fictional king of kings in the middle east 2007 years ago, guided by naught but a star, you could do much worse than take a dromedary as your steed. Able to travel huge distances in arid deserts, losing 30% of their body water, while carrying a huge load of gold, frankinsense, and myrrh, one-humped camels were the ultimate in desert transport; due to the lack of water, ships are pretty useless.

With their double row of eyelashes, ability to drink 100 L of water in 10 minutes, and a hump containing 35 kg of fat meaning they can go two weeks without food, dromedaries are supremely well adapted to the desert. The camel hoof is less well adapted to the desert as it doesn't half itch when the sand gets in. But dromedaries are pretty much the best animal to have in the desert and so rapidly did the craze for camels as desert transport catch on, that soon after the first bright spark had the idea to domesticate them, all the dromedaries were snapped up, and there is now not a single wild one left across their original range in West Asia and the Arabian Penninsular. There are, however, half a million feral camels in the Australian outback. Having lost their crown as Australia's best adapted desert mammal, the red kangaroos haven't half got the hump. Australia's honey-pot ants, in which a certain caste has grossly distended abdomens filled with a honey like sugar, are thought to feel totally unthreatened by the camels' presence in their status as Australia's foremost dessert animal.

Ho ho ho.

You've seen this before I am sure, but here's a song about the dromedaries' South American cousins, llamas http://www.albinoblacksheep.com/flash/llama

Animal of the Week -- December 3, 2007

2007-12-03T13:50:00.000Z

Apologies if last week you didn't receive an image with AOTW, so distracted was I by the handfuls of straws and the scrapings from the bottom of the barrel all around me that I neglected to send an image. Mind you, as it was an extinct animal, the images weren't that great, but you can see an impression of the beast here: http://animal-of-the-week.blogspot.com/2007/11/animal-of-week-november-26-2007.html.

This week I am somewhat spoiled for pictures. For the animal is a vision of grace and beauty, very much alive, and seemingly up for posing for a good shot or two. This week's animal is Python molurus bivittatus (Burmese python), one of the world's longest, heaviest, and apparently friendliest snakes. In the Cambodian village of Sit Tbow, Chamreun, a 4.8 m long snake has adopted Sambeth Uon as her companion. Having first crawled into Sambeth's crib when he was a boy and she a 50 cm snakelet, Chamreun has returned to Sambeth after each of several attempts by his parents to relocate her from their home to the wild. Sambeth now says that he loves the python like a sister, and the family's neighbours have adopted the snake as a village mascot believing that she brings luck, she also brings a bloody great feeding bill, munching her way through forty chickens a week.

Growing up to 8 m in length, Brumese pythons are typically wary of people and would rarely seek out human company. Even when kept as pets they aren't renowned as the most affectionate snakes. In 1992, a Florida teenager was killed by his pet Burmese python, the 24 kg snake constricting the 60 kg boy. Suffocating him with a series of deadly coils wrapped around his neck and chest. The snake did not attempt to eat the Florida teenager, although there are records of larger Burmese pythons eating adult humans. Burmese pythons are able to eat food up to one quarter their length and the same weight as them, so Chamreun could make short work of Sambeth, but the boy doesn't seem at all worried about this prospect, saying "She is my best friend and protects me from danger. All my other friends are jealous of her." I am not sure jealousy is quite right, perhaps you want to try terrified, Sambeth.

Popular as pets, escaped populations of these leviathan snakes have established themselves in Australia and the USA. An Australian farmer was surprised when, after the disappearance of several sheep, he went out one morning to find a Burmese python with a sheep sized bulge in its belly trapped under his newly erected electric fence. And an Everglades ranger was a little more than surprised when he came across the grizzly scene in one of this week's photographs a couple of years back, a Burmese python ruptured during the act of swallowing an Alligator, both reptiles dead in a gruesome tableau.

Animal of the Week -- November 26, 2007

2007-11-26T22:49:00.000Z

So sorry about my absence last week,

I shouldn't let work get in the way of what's really important now, should I? So here it is to make up for my absence, a monster animal of the week, for this week's animal is Jaekelopterus rhenaniae.

You will no doubt have heard about the 45 cm claw of a sea scorpion discovered in Germany recently, its owner, at 2.5 m long and armoured with a broad carapace and jointed exoskelton would have dwarfed a human, had it ever met one. Fortunately for us, they've been extinct for more than 400 million years. Indeed, the whole group of sea scorpions are not something you need worry about bumping into on a day out in Bournemouth -- as you might a string jellyfish (Animal of the Week, November 12) or a bunch of chavs -- because they are all extinct, and although most of them did have a long spike at the end of their tails, this probably didn't have a sting in it. Sea scorpions, eurypterids, were possibly ancestors to all scorpions, spiders, and mites alive today.

Along with the 2.5 m millipede Arthropleura, Jaekelopterus rhenaniae is the largest arthropod (the group comprising crabs, insects, tardigrades, and spiders) ever to have lived. By comparison, the largest living arthropod is the Japanese king crab, which can have a leg-span of 3.5 m, but its body reaches only about 40 cm across and it weighs about 20 kg, its two largest relatives would have weighed a darn site more, even before they were fossilised, although the king crab is probably tastier, especially since they were fossilised. Insects and their ilk absorb oxygen through largely passive methods, Arthropleura and Jaekelopterus lived in times when the atmosphere and seas were far richer in oxygen than today, thus allowing the lazy blighters to grow to greater sizes than any modern creepy crawlies.

Anyway, there you go, the sea scorpion, extinct, huge.

Animal of the Week -- November 12, 2007

2007-11-12T08:22:00.000Z

Hello Hello Hello one and all...

This week's animal of the week is Apolemia uvaria (pearl chain or string jellyfish). Although called "jellyfish", this ribbon of wobbly stuff is actually a colony of organisms, like a Portuguese man o' war. Each individual has a prescribed function -- some are occupied by food acquisition, some reproduction, and others locomotion. The component animals are each only a centimetre long, but the whole colony of a pearl chain jellyfish can be up to 30 metres long!

Typically, these great ribbons trail behind their gas-filled sails in deep open seas and oceans, but recently they have been spotted in British coastal waters. While being quite impressive to look at, they are cause for concern; like the Portuguese man o' war they have vicious stings. Several years ago a bloom of these animals caused serious damage to the Norwegian salmon-farming industry as many fish were killed by their sting. Unlikely to be fatal to people, caution is advised as the sting is likened to that of a wasp.

Selma Pollock, 34, and David Jones, 35, were scuba diving off the coast of Cornwall last week. They were having a marvellous time in the clear autumn waters when David spotted something strange, he went to investigate. Seeing the pretty string jellyfish but not knowing what it was he took a piece of driftwood in hand and used it to investigate the strange creature. Selma wondered what David was up to and went to investigate. Her curiosity as to what David was doing waving his wood around turned to horror when she got a little too close, she certainly was not impressed with the pearl-chain necklace David had given her.

Bye then!

Animal of the Week -- November 5, 2007

2007-11-05T09:25:00.000Z

Oooo.... ahhhh!

Gosh! Wow!

Yay!

Ahhhhhhh!

As the cordite-scented mists clear from Britain's green pastures and gardens tomorrow morning, anyone with an ounce of sense will be out sifting through the remains of the bonfires. Being careful not to burn yourself on still glowing embers, if you are lucky you may just find the odd baked remnant of this week's animal Erinaceus europaeus (western european hedgehog), which is delicious served with bubble and squeak and a little piccalilli. Yumski!

Large piles of kindling and tinder are oh so tempting to hedgehogs looking for somewhere to hibernate. So they are perfect traps with which to bag a few of these spiny delicacies. Alternatively, if you want not to contribute to the annual slaughter don't build your bonfire until late today or check any that you have built already carefully, rebuilding on a new site to ensure that there are no hedgehogs therein. Move any hedgehogs you find to a secluded place of safety and refuge away from any bonfires... the central reservations of motorways for example.

Q: Why did the hedgehog cross the road?

Answers on a postcard to animaloftheweek@yahoo.co.uk

Bye my lovelies!

Animal of the Week -- October 29, 2007

2007-10-29T09:57:00.000Z

Hello,

Bets have no doubt been placed on what this week's animal of the week will be. I hear Ladbrookes were offering 3 to 1 on the least weasel, and William Hill had stopped taking bets on the Yeti (a bear with mange? No way Jose! http://www.ogpaper.com/news/news-01178.html) Sunday at 6 pm.
Those among you thinking that I might reprise the Androscoggin beast (http://animal-of-the-week.blogspot.com/2006/08/animal-of-week-august-21-2006.html) or vampire bat (http://animal-of-the-week.blogspot.com/2005/10/animal-of-week-october-31-2005.html) in honour of Hallowe'en, are sorely mistaken: I simply don't have enough weeks to repeat animals. No, this week's animal is more frightful and terrifying than the unlikely offspring of the all four. For this week's animal is the undying, undead, perhaps immortal Arctica islandica (ocean quahog clam, Icelandic cyprine).

Over 400 years ago, as Shakespeare was writing some of his finest comedies and The Merry Wives of Windsor, as British settlers were staking a claim to parts of North America, as the Dutch were routing the Spanish at the Battle of Gibraltar, as the Ming Dynasty was ruling China, as Menzies Campbell was contemplating joining the Liberal Democrats, and as Joan Rivers was having her first course of botox, a quahog was taking up residence on the north Atlantic seabed. Little did it know that having weathered four centuries of sucking the life out of sea water, this clam would be dredged up by scientists from Bangor University (oh, the shame, Welsh!) and slice apart in the name of science. Its ignominious end at the hands of marine biologists has secured a place for this mollusc in the record books as the oldest know animal.

For comparison, the oldest know human was Jeanne Calment, a French chain smoker who outlived her grandchildren and eventually pop her clogs at the ripe old age of 122 and the oldest know tortoise was Adwaita, Clive of India's tortoise, which died last year after an innings thought to be about 250 years. This quahog, the age of which was determined by counting growth increments in its shell as one might count the rings in a cut tree, knocks both into a cocked hat and surpasses other records for its own species by about 30 years. Doesn't really have much on the various pine tree species that live upwards of 10 000 years, but who gives a fig about plants?

Well done that clam!

Animal of the Week -- October 22, 2007

2007-10-22T11:14:00.000+01:00

Distressing news Ani-freaks, the devil facial tumour virus that is wiping out Tasmanian devils has spread to a previously uninfected population that had been viewed as a safeguard for the species' future. Now conservationists think that finding uninfected wild devils may be impossible from the middle of next year. Once infected the tumours impede feeding and lead to starvation within 6 months. Eeek! Could this be it for the inspiration for a much loved cartoon character? Could the Tasmanian devil soon be heading the same way as this week's animal of the week, its larger, more ferocious, and more extinct cousin Thylacinus cynocephalus (Tasmanian tiger, Tasmanian wolf, thylacine)?

Neither tigers nor wolves, thylacines were the largest marsupial predators to survive into modern times and were a little smaller than a wolf. Once widespread across New Guinea, mainland Australia, and Tasmania, they became extinct on the mainland about 2000 years ago, and by the time Europeans arrived, their range was, like that of the devil, restricted to Tasmania. Viewed as a threat to livestock, a bounty of £1 for adults and 10 shillings for pups, was paid for their capture; at about the same time in Tasmania the bounty for aborigines was £5 for adults £2 for children.

By 1900, thylacines were hard to find (the aborigines were impossible to find by this time) and a conservation programme was set up in 1901 to safeguard the species for addition to collections and zoos. However, the combination of persecution, habitat loss, and disease had sent the species into terminal decline. Benjamin, captured in 1933, was the last known living thylacine, and he resided in Hobart zoo until his death in 1936. There have been many reported sighting of thylacines from New Guinea to Tasmania since 1936, but none has been verified, although many people believe they still cling on in remote regions, in 1986 they were declared officially extinct and any attempt to study their presence in the wild is branded as cryptozoology.

Although named Benjamin, the gender of the last thylacine was unknown. While we're on the subject of gender, thylacines were one of only two types of marsupial in which the male had a pouch. The pouch was unlike the females' pouches, but like those of the male South American water opossums, the male thylacine's pouch was used to support their pendulous scrotum!

With an enormous gape and an incredibly strong jaw (pound for pound they probably had the greatest bite pressure of any mammalian carnivore), thylacines were fearsome beasts. Although there is no evidence to suggest that they were a threat to humans, as this week's photo shows they could easily fit the head of a prat with a dodgy moustache into their mouths (the moustache is also extinct, or at least hiding very well in a protobeard).

OK, bye then!

Peter Hayward
Head Keeper
Animal of the Week

Animal of the Week -- October 15, 2007

2007-10-16T11:28:00.000+01:00

Hello!

I tell you what, I am sorely tempted to revisit an old animal of the week http://animal-of-the-week.blogspot.com/2005/03/animal-of-week-march-21-2005.html. Great quantities of harlequin ladybirds hang in the air outside and off the external walls of the flat looking for a way in. A cluster of the blighters having formed around the curtain-pole fitting in my landlady's room, her application of brief squirt of insecticide spray quickly had a shower of these pernicious beetles clattering to the floor. Don't feel too bad about this, they are a non-native species (unless you live in the far east) and, well, even though it won't make a difference to their inexorable march across Europe or North America, it's one in the eye for the native ladybirds. Obviously, if you choose to annihilate the plagueybirds, be careful that you are killing the harlequins and not native species of ladybirds, which need all the help we can give them.

But why should I give such a creature two weeks? So, this week's animal is Antidorcas marsupialis (springbok). Their name is a conflation of the Afrikaans words for jump and antelope, and springboks are graceful gazelle like creatures from south and southwest Africa. With a dramatic black stripe along either flank and sweeping lyre-shaped horns springboks are instantly recognisable. And if in any doubt about whether you are looking at a springbok or not, scare it. When agitated, springboks jump stiff leggedly into the air with their heads pointed to the ground, taking off again as soon as they land, they also raise a flap of skin along their back that splays long white hairs coated in a floral scent. This activity known as pronking might be a signal to predators that they have been spotted and that the springbok can outrun them, or it might be an indication that the pronking springbok is in excellent health and that the predator would be better off going for a non-pronker.

And what are the predators of springboks that induce such pronking in the wild? Yeah, that's right, lions... If only I could make this topical in some way...

If I had a pet springbok, ok, I would probably have to have a licence, but most importantly I would call him Rodney, I'd take him for a walk down the road to Peckham, I'd stand him outside one of those butchers that sell every kind of meat imaginable, most with the heads still on with their glassy clouded eyes staring accusingly at the pedestrians, until he became nervy and started his display. I'd then stand there and point at him loudly exclaiming "Oh Rodney, you pronker". I'd then run away giggling, a disdainful and slightly hurt springbok trailing behind me on a string.

Thanks chaps,

Peter Hayward
Head Keeper
Animal of the Week

ps, having struggled this far through AOTW, you will be shocked to learn that I am both an editor and a writer. Now that my MSc is over and before I have to return to selling what god gave me for £20 a pop above a Soho hairdressers, I am looking for freelance/temporary/permanent work. Do you know anyone who needs any editing and/or writing done? If so, please let me know.

Animal of the Week -- October 8, 2007

2007-10-08T12:53:00.000+01:00

There's somebody at the door, there's somebody at the door!

Those of you who observe the days of the Saints may have marked October 4, the feast day of renowned hermit and animal lover Francis of Assisi, by having your pet blessed at your local catholic congregation on this Sunday just gone. And what pet did you have blessed? Maybe a cat or a dog, or a cat, or a dog, or another dog? Poor priests, the highlight of their day would be some batty ageing zealot bringing in a fluffy toilet-seat cover. Well, here's some wonderful news for priests in the UK, next year's animals may include any one, or perhaps all, of 33 species for which a special licence is no-longer required to keep them as pets. And what a list of species--do you fancy owning a kodkod (a miniature spotted cat), a cacomistle like Paris Hilton's Baby Luv, perhaps a raccoon called Bert, or maybe this week's animal of the week Dromaius novaehollandiae (emu).

An emu is approximately the length of a man's arm from rear to beak, its blue-purple shiny plumage and bright red neck make the bird instantly recognisable. Emu can afford to be showy and conspicuous, because its terrible temper ensures that it has no natural enemies but for a fat green witch, but when threatened the emu seeks shelter in a pink windmill with a bunch of kids and a strange old man who looks for all the world like the love child of Willy Wonker and Wurzel Gummage. JUST KIDDING, THAT WAS A KIDS TV PROGRAMME FROM MY YOUTH YOU SILLIES! (Although I didn't watch it because it was on ITV.)

At 2 m tall, emus are the largest birds of Australia and the second largest extant birds. Like their cousins, ostriches, cassowaries, rheas, and kiwis they are flightless. Rod Hull's emu, much like the man himself[thanks A Watts], was also flightless, but real emus are brown-grey with a blue-grey neck, and very rarely have a man hanging out of their bottoms...mind you, some parts of Australia are very remote and a man could get lonely. Able to run at speeds of up to 30 miles per hour for sustained periods of time, emus leg muscles make up a similar portion of their body weight as do the wing muscles of birds that have not lost the power of flight, and like turkey breasts, the legs of emus are a tasty low calorie treat. Besides their meat, emus are farmed in Australia, North America, Argentina, and Chile for their leather, feathers, eggs, and oil. Yes, their oil...used mostly in cosmetics and dietary supplements, emu oil is also thought to have anti-inflammatory properties.

So, there you go UK folks, no longer do you need to worry about getting a licence for your emu, hiding it when the inspectors come around, or insisting you only use it to watch DVDs. Get one, rejoice, and next feast day of St Francis, take it to your priest and brighten up his day with a little variety. Or simply feast on your emu if you aren't that bothered about saints.

Animal of the Week -- October 1, 2007

2007-10-01T08:58:00.000+01:00

Hello one, hello all,

There are probably more than just a few fans of Sandi Toksvig (and no that is not code) among the readership of AOTW, so I would like to apologise up front for the recycling of a joke made by the diminutive Dane on the News Quiz last week. The joke will naturally stick out like a sore thumb among the remainder of my humourless rambling.

This week's animal is Crocodilus porosus (saltwater or estuarine crocodile), the largest reptiles alive in the world today. All around the eastern Indian Ocean and into parts of the western Pacific, these humongous reptiles inhabit the coastal waters and freshwater swamps, rivers, lakes, and billabongs. Pretty much anything is on the menu for salties, from dragonflies and tadpoles for the chicks, to people, dingoes, leopards, kangaroos, and water buffalo for adult males. The largest male ever recorded was 8.6 m (28.3 ft) long, for such a beast Toksvig would have been a mere morsel.

Saltwater crocodiles are thought to be the only animals that think of people as regular prey and they cause about 300 deaths worldwide annually. Although the big question is who would win in a fight between a shark and a crocodile. The largest great white and the largest bull saltie are well matched in size, although sadly for them as love a good "who would win discussion", they'd never meet, crocodiles having a tropical range (and the largest ones mostly fresh water) and great whites being animals of temperate regions. Should the crocodiles meet the slightly more diminutive tiger sharks, the two would probably ignore each other, both preferring easier prey, the shark might take smaller crocs, and the croc maybe smaller sharks (see pic).

Of the 23 species of crocodile or alligator in the world today, the saltie is the least endangered, although in parts of south Asia and the Pacific these magnificent beasts have become locally extinct due to habitat loss and conflict with people Fortunately the vast empty expanses of northern Australia and New Guinea and these animals remarkable ability to disperse through deep ocean water means that the species should be safe.

Where they do come into conflict with human beings in Australia, policy has been to transport them from residential areas and pleasure beaches to areas not frequented by people. However, researchers tracking relocated animals were surprised to discover that some had navigated up to 150 miles to make it back to the area from where they were removed. Turns out that saltwater crocodiles, particularly the males, are highly territorial. They travel great distances through rivers and coastal waters to find patches not already inhabited to which they can stake their claim and once they find them, they stick to them.

Will this discovery see Yorkshire folk forsaking their homing pigeons in favour of these distant relatives of birds for crocodile races? Probably not until global warming really kicks in. Although the ability of these cold-blooded, dangerous, ancient reptiles to traverse great distances to navigate home after long periods of time does at least explain Margaret Thatcher's recent reappearance at Number 10 (thanks Toksvig).

Bye!

Animal of the Week -- September 24, 2007

2007-09-24T12:01:00.000+01:00

Good Monday Anifreaks!

Honourable mention to Paul Genders (age 27 and five-sixths) who was the only person to tell me that Xestus is the name of the Greek god of sea and ocean currents who helped to guide the Argo on its journey. Well done Paul, and many many thanks.

Onwards and onwards.
This week's animal of the week was brought to my attention by a friend with whom I went to see Feist last night, a grown man wearing a lovely knitted jumper with the shape of a shark emblazoned across it in red, taking up a good fifty percent of the area of the jumper frontage. With its broad head and tapered streamlined body, its stiff projecting pectoral fins and menacing pose, I recognised the animal instantly... but that's enough about my friend.

Unfortunately for my friend, his jumper had been attacked by this week's animal of the week Tineola bisselliella (common clothes moths). These little blighters seem to be plaguing people a bit this year, as this was not the first assault on a wardrobe I had heard of this year, not by a long chalk.

Clothes moths used to be important pests, but increased use of manmade fibres, less-humid housing due to central heating, more dry cleaning, and greater use of insecticides have led to a decline in damage. Nevertheless, when they do get in among your woollens, furs, and natural fibre carpets their effects can be most vexing.

The entirely anecdotal and unfounded plague of moths this year, the presence of which I have inferred from a few accounts of acquaintances and things written on internet forums (that's what a year of postgraduate science education does for you) is likely due to one of three things: global warming leading to a very wet summer, terrorism, or government conspiracy (an umbrella term for the previous two options anyway).

My love for all the animals (except slugs) is well documented, so I'd like to encourage you all to look on the bright side of common clothes moths. If you clean out your cupboards and vacuum thoroughly you should be able to control an infestation. The moths are particularly attracted to clothes with remnants of perspiration, food and drink spillages, or urine on them, so perhaps there are one or two lessons to be learned from an infestation anyway. And failing all that, because they start with the most accessible bits of your clothes, the holes they make in the cuffs of your jumper are ideal to put your thumbs through when the inevitable second grunge revival strikes (the first grunge revival occurred when I had an infestation of clothes moths in East Finchley in 2001 [ie, the heyday of emo]).

Many thanks,

Peter Hayward
Head Keeper
Animal of the Week

ps, having struggled this far through AOTW, you will be shocked to learn that I am both an editor and a writer. Now that my MSc is over and before I have to return to selling what god gave me for £20 a pop above a Soho hairdressers, I am looking for freelance/temporary/permanent work. Do you know anyone who needs any editing and/or writing done? If so, please let me know.

Animal of the Week -- September 17, 2007

2007-09-17T11:06:00.000+01:00

Hello one, Hello all

Many thanks for your responses to my previous missive, it seems that many of you hold cartoon series Dungeons and Dragons in great affection, more than one of you seemed to harbour, er, special fondnesses for particular characters.

Anyway, enough of that nonsense. A recurring theme over the past month or so has been that of animal alphabets, first a very dear friend comes to visit and she is wearing an animal alphabet T shirt, then the following weekend I go to the Green Man festival, I turn up the day after most of the people with whom I was staying, and they tell me that the night before they had been playing a game in which participants have to name an animal starting with each letter of the alphabet.

Both on my friend's T shirt and in the Green Man naming game two letters caused particularly problems, not the Q and the Z as you might expect—quaggas, zebras, zorillas, quillas, zanders, quetzels, and zebu provide plenty of options—but surprisingly U and, perhaps predictably, X. Now, where previously in such pastimes you had to make an exception for a fictional unicorn for U, you have the previous animal of the, erm, week, the uakari. But what about that pesky X?

At the Green Man festival an ever-astute Welshman recalled the X-ray fish, a small aquarium fish with see-through skin (the kind of skin you can see through), and that was going to be this week's animal...until I spotted another fish with a name beginning with X. This week's animal of the week is Petroscirtes xestus (xestus fangblenny, bearded sabretooth blenny). Blennies are small coastal fish, and this species is no exception, unremarkable and typically brown. Fangblenny just sounds so oxymoronic, the equivalent of "werehamster", "vampire tit", "The Sloth of the Baskervilles", or "murderous death sprat of terror".

There's not much more to say on the matter of the xestus fangblenny. I have no idea what xestus means, do you? Answers in an email please, the prize being an honourable mention in next week's AOTW.

Peter Hayward
Head Keeper
Animal of the Week

ps, having struggled this far through AOTW, you will be shocked to learn that I am both an editor and a writer. Now that my MSc is over and before I have to return to selling what god gave me for £20 a pop above a Soho hairdressers, I am looking for freelance/temporary/permanent work. Do you know anyone who needs any editing and/or writing done? If so, please let me know.

Animal of the Week -- September 03, 2007

2007-09-03T23:11:00.000+01:00

HELLO! HAI! HOW ARE YOU ALL?

I do hope that everyone has had a marvellous August, I know I have. So much has happened: floods, fires, new Harry Potter film and book, another series of Big Brother over, the baiji extinct then not extinct, but probably dead in the water whatever... It has been so very long, I am not sure I know how to do this anymore. Please forgive me if this is a little ropey, I am sure I shall be back up to speed next week.

Anyway, this week's wizard of the week is Venger from the classic TV series Dungeons and Dragons... Venger was a pasty-faced cross dresser who in an act of rebellion as a teenager filed his teeth and started wearing a cape. He never grew out of the goth phase.

Lording it over the evil and corruptible characters of The Realm, Venger repeatedly tried to trap, trick, crush, or magically imprison Hank, Diana, Presto, Eric, Bobby and the useless unsteady bint with the invisibility cloak to rest from them the gifts bestowed on them by Dungeon Master to help them navigate their way home. Venger was thwarted at every turn, which given that his foes were a bunch of kids who arrived from another dimension on a fairground ride who didn't know how to use their magical weapons and, in some cases, could barely stay upright for more than five minutes suggests to me that he had the wizarding skills of a teaspoon.

Venger's mortal enemy in The Realm was a five-headed dragon called Tiamat, named after a goddess of Babylonian mythology. Whenever the two squared up Venger would, almost without fail, flee in the knowledge that whatever artifice he could come up with was no match for Tiamat's powers of burning and freezing and speaking like Bea Arthur on helium.

Most of Venger's problems likely stem from the fact that his father was the walking nutsack, Dungeon Master. An interfering gnome-wizard whose main power was to appear and disappear when walking behind rocks, Dungeon Master was supposedly trying to help the kids find their way home and stop Venger getting hold of the magical gifts he gave them. Although given his purported wisdom, he should have realised that if they were ever going to get home, Bobby and his mates needed to ditch the bloody unicorn for a start.

Venger was the name of the car on the story on the sleeve of Kenickie's 1995 Skillex EP. So there we are, wizard of the week, Venger....

... what?

... animals?

... really?

... why would anyone do that?

A what? Oh, right, a zoologist, uh, I thought that was all a dream... ... OK... have this bum-headed monkey... Cacajao calvus (bald uakari). The name uakari is believed to be derived from an Amerindian word for Dutchman.

See you next week lovelies!

Px

Animal of the Week -- July 30, 2007

2007-07-30T21:30:00.000+01:00

So, I'm thinking, I need to do animal of the fortnight, and in the UK at the moment it's all great white sharks off Cornwall. Are the maneating leviathans really there? Possibly, probably not, the sharks seen are more likely to be basking sharks (bigger than great whites but filter feeders), porbeagle sharks (smaller than great whites, but large and fast, though nothing to worry about), or mako sharks (larger than a porbeagle, smaller than a great white, but large, fast and fierce, although not a maneater). And I am looking up information about these sharks, and then I spy the name of an animal of which I had not heard before, Alepisaurus ferox (longnose lancetfish)

Now, lancetfish are large predatory fish that eat smaller fish and small swimming crustaceans. They are considered pests by tuna fisheries where they take the bait from hooks and their watery flesh is not considered worth eating.

Quite unremarkable really, however, I was tickled by the name because it includes my former employers, The Lancet, a medical journal. Appropriately for a fish that shares its name with the august medical organ renowned for its "stand on several important medical issues - recent examples include criticism of the World Health Organization, rejecting the efficacy of homeopathy as a therapeutic option and its disapproval of Reed Elsevier's links with the arms industry [Source Wikipedia]", lancetfish have sharp teeth, hunt by ambush, and have a big mouth.

Their insipid watery flesh is, I would like to stress, less like the contents of The Lancet. And as for their purported aphrodisiac powers, well, I would be too abashed to comment.

Please forgive me this minor indulgence, it's a bit of a rubbish AOTW I know. But there you go. Also, I am going to take the next few weeks off. A small matter of a dissertation and shabby work ethic mean that I am likely to need all the minutes I can find. But AOTW will return per week and reinvigorated in September. I wish you all a lovely summer.

Animal of the Week -- July 16, 2007

2007-07-16T18:12:00.000+01:00

Well, it's that time of year again, when an afternoon outside becomes a constant battle against foe whose endless onslaught is like nothing seen outside a Lord of the Rings battle scene. No sooner have you shaken one from your hair than another lands in your cleavage, and when you've picked that out, you find three have landed in your drink/on your ice cream/in your mouth. And what is this haphazard winged plague of summer? Lasius niger (black garden ants), that's what.

You may wonder what triggers this aerial onslaught, when generally ants aren't that noted for their flying, and are most annoying for dying in your sugarbowl. Our insect tormentors are either queens, the most prominent fat ones, or males, the little ones that you see but don't really mind about because they're much less custardy. This is the only time that the ants will fly, hence their lack of proficiency.

On this, their nuptial flight, the males and females will mate, and with the juices of the male safely apportioned, he will die, the queen will lose her wings and tunnel underground and begin to lay eggs. The fertilised eggs hatch and the larvae become female workers. Throughout the rest of the year the colony swells as more and more workers hatch out of the never ending supply of eggs from the distended and immobile queen. The colony spreads further and further looking for food, getting into your cupboards dying in the threads of your jam-jar lids, wandering off with the contents of picnic baskets, and getting in your pants. What else do ants do?

As summer approaches, the workers decide it's time for the success of the colony to be spread even further, and they select some eggs (still fertilised by the product of the nuptial flight) to raise as dispersing queens, and the queen lays some unfertilised eggs that will become males. Triggered by cues of daylength, temperature, and humidity with astounding and fearsome synchronicity colonies all over an area crack open and the winged horde takes flight. The mass eruption means that queens of one colony might mate with males of another rather than with their own brothers.

The flying menace some years reaches such proportions that they clog air-conditioning and trigger mass congregations of sea gulls and swallows, which come to feast on the glut. Humans deal with the event by flapping, moaning, squashing and beating them from the sky with badminton racquets. I say let them be, they'll be gone as soon and as suddenly as they came.

One downside of black ant for the gardeners among you is that they farm aphids, protecting them from predators while harvesting a sticky secretion called honeydew (the nasty smut that gathers on a car parked under a lime tree). In the picture, a black ant is carrying an aphid in its jaws.

Animalof the Week -- July 9, 2007

2007-07-09T08:03:00.000+01:00

I worry that I am starting to sound a bit like a countryside diary of late, what with my tales of cockchafers, pigeons, swifts, and other things that I see as I pootle around London, such as piranhas and golden moles. So this week I am going to resist the temptation to regale you with the tale of peregrine falcons spotted over Clapham on Sunday morning.

Instead, this week's AOTW is something a slightly larger and much rarer bird of prey. Rarer to the extent of being extinct, for about 6 million years. This week's Animal of the Week is Argentavis magificens (giant teratorn). This relative of the living condors was the largest flying bird ever to have lived. With a wingspan of up to 8 m (28 feet) and weighing possibly as much as 100 kg (220 lb). For reference, a wandering albatross has a wingspan of 3.83 m, modern day Andean condors have a wingspan of 3 m and weigh up to 12 kg, and the heaviest flying birds, European (AOTW, April 11, 2005) and Kori bustards weigh no more than 20 kg.

The teratorns were large birds of North and South America that lived from the Miocene to the Pleistocene (15 million to 11 thousand years ago), and this species survived in Argentina from 8–6 million years ago. Other teratorns were not much larger than the modern-day condors, but Argentavis magnificens was truly a monster. People have speculated whether and how such an enormous bird could fly, but the imprints of feather attachments on the birds wing bones (an upper-arm bone would have been the same length as a whole human arm) show that they had flight feathers. Fortunately, the lack of the Andes in South America at the time these birds lived meant that strong westerly winds whipped across the continent, which would have helped the bird take to the sky with a little running around and flapping.

Whether these birds scavenged or hunted is also a bone of contention. Other teratorns almost certainly hunted, because they resembled eagles, which hunt, much more than they did their close relatives condors, which scavenge. But could a bird this size be an active hunter? Perhaps it did a little of both, driving the marsupial lions away from their kills of giant sloths or weird camels with trunks (South America was different then) when the opportunity arose, and when it didn't, swooping down on animals up to the size of hares and small dogs, picking them off the ground, and swallowing them whole.

This week's image may not be entirely accurate. Certainly Argentavis magnificens would never have soared over the heads of Japanese cartoon characters, or any humanoids for that matter. Furthermore, the head may not have been bald. But there you go, needs must when you need to steal a picture.

What a bird!

Animal of the Week -- July 2, 2007

2007-07-02T14:41:00.000+01:00

What a week for news!

On the plus side Tony Blair has gone, and although ballots were absent in the selection of his successor, and East Timor have held their first public democratic vote, and although the count is slow, the process looks good. On the downside, floods have ravaged the north of England and various US states, Wimbledon has barely started, the UK is on the highest state of terror alert after some deluded fanatics tried to car bomb London and Glasgow, and perhaps worst of all, to compound all the misery in the world that I have not been able to summarise in my brief introduction so far, the Spice Girls have reformed.

Thank god that news about animals tends to be more neutral, like that about this week's animal Pygocentrus nattereri (red-bellied piranha), in fact, this news is just about the best and most complete image overhaul sine Paris Hilton vowed to invest her time, money, and, er, intellect for good on her release from jail. For researchers now claim that piranhas are not the frenzied, blood thirsty, pack predators capable of stripping a cow carcass in minutes, but rather their shoaling behaviour is driven by cowardice in an attempt to avoid predation by river dolphins (AOTW, Feb 21, 2005: http://animal-of-the-week.blogspot.com/2005_02_01_archive.html), caimans, and the enormous fish that live in the amazon.

Now, I can't find out the exact species of piranha studies, but at red-bellied piranhas are some of the most aggressive, and certainly not the sort of fish immortalised in the "One, two, three, four, five, once I caught a fish alive" nursery rhyme, which would no doubt have a different ending if it were.* Most piranhas are vegetarian anyway, and the most aggressive ones, such as this and its close relatives, are likely to have been the subject of the study, if not, why bother?! Apparently even these typically only hang around in small shoals and prey on small fish, carrion, or bits of larger fish. According to the researchers, they only form large shoals when the waters recede and they are more prone to predation, and not for the purposes of hunting large animals and stripping the flesh from captured secret agents at the behest of Ernst Bloefeld.

Of course, you may have seen demonstrations of these voracious fish stripping a chicken carcass to bare bones in seconds, and they will do that, but only when kept in small tanks and deprived of food. Despite this image makeover for the piranhas, you still can't keep them in aquaria with smaller fish, they'd eat them.

*One two three four five
Once I caught a fish alive
Six seven eight nine ten
Then I let it go again
Why did you let it go?
Because it bit all my fingers off and I didn't have a choice.

Tak tak,

Animal of the Week -- June 25, 2007

2007-06-25T09:26:00.000+01:00

Being a little UK and summer centric at the moment, I know, but I am like some weird child who can only think about what he sees, you know that by now.

This week's animal of the week is another sure sign and sound of summer, so tightly associated with the season in my mind that just thinking about them gives me a tan, which, given the weather here at the moment and my lack of holiday funds, is the only way I'm going to get one this year. This week's animal is Apus apus (common swift).

Flocks of these most aerial of all birds wheeling over the village squares, town halls, and city skyscapes screaming and careening in pursuit of airborne plankton are a common and stunning sight across Europe. Appearing in early May and remaining until late July. Outside their brief visit to these temperate climes, swifts fly thousands of miles to sub-Saharan Africa.

Common swifts live nearly their whole lives on the wing, they are even able to sleep in flight. Their nests are made from floating feathers, petals, and light grasses gathered on the wing and glued together with spit, and all their food -- small insects and floating spiders -- is caught in flight, scooped up in kamikaze dives near the ground or sifted from the atmosphere so high up that from the ground the birds become tiny crescent-shaped specks. Swifts never land on the ground, only punctuating their endless flight with occasional breaks clinging to vertical surfaces with their tiny feet (apus means no feet) and their brief nesting period.

Although they look like swallows and martins, and have similar migratory patterns, swifts are more closely related to hummingbirds than any other birds, weird. You can distinguish swifts from swallows and martens as the former are slightly larger, and their wings are more curved, appearing as a perfect sickle. Swifts also never land on the ground, only punctuating their endless flight with occasional breaks clinging to vertical surfaces. Their exhilarating, screaming call also sets swifts apart. One swallow may not a summer make, but for me, a flock of swifts, certainly helps.

I think my contemplative mood today is evident, so you can do your own swift swallow martin innuendo yourself. Oh, there you go then.

Animal of the Week -- June 18, 2007

2007-06-18T10:55:00.000+01:00

Hello!

It was playing on my mind recently that I had not seen any of this week's animal of the week yet this year, despite it being associated with the month of May and only really being active in European parks and gardens during the early warm summer months. But then, there I was, hanging around the flower gardens of Kennington Park as dusk approached this weekend when a series of rustling, the occasional bumps, and random banging announced the arrival of several of the large and hairy Melolontha melolontha (cockchafers).

Cockchafers (no sniggering at the back), are large beetles that emerge in May and can be spotted flying rather haphazardly whirring through the sky and bumping into trees, buildings and people around green spaces, and feasting voraciously on plant material, particularly oak trees, but also crops, until the end of July. They are particularly active late in the day, so, for example, in London, Hampstead Heath as dusk approaches is a good place to find cockchafers.

Their larvae spend 3 years eating roots and tubers growing to a size of 5 cm, they pupate in autumn, but the adults overwinter in the soil emerging in May. Until recently, cockchafers sometimes reached plague proportions, causing devastation to crops, typically in 30 year cycles. The main measure to combat them would be to collect the adults and disrupt the breeding cycle, this tactic led to inventive recipes for sugarcoated cockchafers and cockchafer soup. Although largely ineffective, this method was far more successful than that employed in Avignon in 1320, when cockchafers were tried in court and ordered to retreat to a specially designated area!

Neither legislation nor culinary endeavour eventually brought the cockchafer under control. The introduction of chemical pesticides decimated their numbers, but in recent years they have had something of a resurgence and parks, gardens, and open spaces across the UK and Europe resound with the sounds of the crepuscular activities of cockchafers.

At about 2.5 cm long and being such a large and noticeable beetle, they have fired the imagination of people, and in the UK alone they have a great many names: not only the suggestive cockchafer, but also the half-right "May bug", the conflicting "July beetle", the unbelievable "spang beetle", and the Spoonerism-tastic "billy witch".

Animal of the Week -- June 4, 2007

2007-06-04T22:14:00.000+01:00

After five whole months in exile following the festive avian glut at Christmas, the ornithologists, twitchers, and bird fanciers among you might be pleased to hear that this week's animal is an ave. Although you may be less excited to hear that this week's animal is actually Columba livia domestica (domestic pigeon, feral pigeon, rat with wings).

Now, the coincidence is striking: this time last year I related to you a tale of bloody murder http://animal-of-the-week.blogspot.com/2006/06/animal-of-week-june-5-2006-islington.html featuring a herring gull, a pigeon, and the Regent's Canal. I have not seen anything like it since, that is, not until yesterday evening. Stood in the waterfront bar of King's College Union attending a gig by Australian wonderband Architecture in Helsinki and overlooking the Gormley dotted skyscape of the Southbank, my eyes were drawn to a commotion in the sky above the river by Gabriel's Warf. What first appeared to be a dogfight among a group of lesser black-backed gulls was actually aerial pursuit. Barrelling along in front of the five or six gulls was a pigeon -- scraggly, dirty, unloveable, and unloved. Diving this way and that, skimming the treetops, hurtling towards buildings in a deadly collision course before wheeling away at the last minute, the little thing was desperately trying to shake off its pursuers. The dastardly gulls matched the pigeon's every move, frequently seeming to catch up with the pigeon trying to nab him, jab him, tab him, grab him, but never quite getting more than the tip of a tailfeather.

From Blackfriars to Waterloo the birds shot, from north bank to south. Disappearing from sight for a few moments, they would dramatically reappear from above outside the gallery windows at King's Union. I, and other interested onlookers (ie, the kind person I was with who was too polite not to feign interest), watched the dramatic chase for a few minutes. The pursuit was lost to sight finally, but a flock of gulls reappeared shortly after, no pigeon among them, so I assume it escaped.

So, I am pleased to report that the pelicans and the gulls that have turned pigeon killers don't always have it their way. The escape of domestic pigeons has made this species perhaps the most widely distributed non-migratory species of bird, being populous among many cities, with plenty of places being famed for their large flocks. Descended from rock doves, although there are a variety of domestic forms (see the Jacobin breed in the pics), most feral versions have reverted to a rock dove shape with varied colour. They might be a pain sometimes, yes, and being crapped on one cannot be considered lucky, but none of their badness is their fault, they just do what comes naturally in the unnatural settings created by people with all the ideal nesting sites and plentiful discarded food. Talk of pigeons fouling the street occur in Mesopotamian scripts of 4000 years ago; and in classical Rome, large colonies were plundered as a source of fat young pigeons, squabs, for food. They are remarkable animals, adapting better than almost any other to the manmade environment.

One of the domestic pigeon's most famous skills is its ability to navigate home over great distances, up to 1000 km, of unknown terrain. This trait was used to great effect during various wars, when the birds were used to send messages from the frontlines, and a couple of pigeons have been awarded medals for their contributions to war efforts. A lesser known ability that people have claimed for pigeons is an ability to distinguish between impressionist and cubist paintings. In 1995, scientists encouraged a pigeon to sort artwork, after a little training, in which pigeons were rewarded with food for pecking at Picassos but given nothing for pecking at Monets, they soon only ever pecked at Picassos. When new paintings and other artists were included the pigeons could still distinguish between the two schools. And like the punchline to some appalling 1970s sitcom joke in which a dowdy conservative tries to get to grip with modern art, when the paintings were turned upside down, the pigeons didn't know what to do with the impressionist work, but continued to behave as ever with the cubist pictures.

Big up the pigeons!

Animal of the Week -- May 28, 2007

2007-05-28T17:57:00.000+01:00

Sorry, sorry, sorry.

Animal of the Week? Animal of the Fortnight more like!

Still, just time for one more marsupial for May. And this week's is a weird but beautiful creature. It's Notoryctes typhlops (southern marsupial mole)!

Like moles of the northern hemisphere and the golden moles of Africa, marsupial moles are extremely highly adapted to a burrowing (or fossorial, to use the technical language) lifestyle. Like the others they have big shovel-like claws on their front legs, hard nose, fused neck vertebrae, and they are blind because where their eyes should be, there is merely skin and lovely cream coloured velvety fur.

Living in desert environments, these moles swim through the sand searching for worms, witchetty grubs (http://animal-of-the-week.blogspot.com/2006/11/animal-of-week-november-13-2006.html), other larvae, and the occasional lizard. Another cunning adaptation to the fossorial lifestyle, this marsupial's pouch (or marsupium, to use the technical language) points backwards.

Once, the two species of marsupial mole were thought to be monotremes related to the platypus and echidna, not marsupials at all. Until recently their incredibly specialised form confounded taxonomists who were unable to work out how they were related to other marsupials. But actually these moles are most closely related to carnivorous marsupials such as numbats, Tasmanian devils, quolls, and the recently extinct Tasmanian tiger.

So anyway, this is the marsupial mole, it is animal of the week, and I am off now.

Byeee!

Animal of the Week -- May 14, 2007

2007-05-14T08:07:00.000+01:00

And let it be known that May 2007 was the month of marsupials. For this week's animal of the week is Monodelphis domesticus (grey short-tailed opossum, or grijze of gewone kortstaartopossum for my Dutch readers).

Hopping continents from last week's Australasian representative of the marsupials, this wee mouse-like marsupial hails from the forests of Brazil and Bolivia. Arboreal in habit and unremarkable in many respects, the grey short-tailed opossum is most notable for being the first marsupial to have its genome sequenced (published in the journal Nature [I have obligations]). A popular laboratory animal, scientists hope that knowledge of its genetic make up will provide insights into how its babies, which are born at about the same developmental stage as a 40 day old human foetus, manage to survive simply clinging to the teat of their mother without an immune system and how the young repair their spinal cords if they are severed. Comparison between this genome and that of other sequenced mammals, such as human beings, chimpanzees, and mice will reveal some of the major differences evolved since the divergence of marsupials and the rest of us some 180 million years ago.

Given that the word marsupial is derived from marsupium, it seems a damn cheek that these animals don't have a pouch -- the young simply hang from their mothers' teats. The word opossum comes from the native-American Algonquian word "wapathemwa" for the Virginia opossum. The word the comes from the word.

And for the DNA freaks amongst you here's a joke:

ACGAAATTTATGGGCACACGGGGCGCAATTGGTTTGGCCCAAACCACACATTTGT
TTCTCCCGAGTCCCGAGATCACATTCGAGCCTCTCACTACTAGCAGACGACGACT
ACATATACT

ORF ORF!

Animal of the Week -- May 7, 2007

2007-05-07T08:46:00.000+01:00

Although Andrew Motion was quaking in his boots when he first saw last week's effort, he was quickly relieved when he spotted my egregious error in suggesting that the people conned in the poodle scam had been given back their mediaeval instrument rather than their "loot". I would like to say that I spotted the error myself, but if I told you that I would be a lyre.

Crashing on, this week's animal of the week is Dendrolagus mbaiso (dingiso, bondegezou). This cute little bundle of loveliness is a tree kangaroo from the Western New Guinea region of Indonesia. I always found it bizarre that a kangaroo should climb a tree, but dingisos are doubly weird as their ancestors came back down from the trees and they are largely terrestrial, spending little if any time in trees. Such evolutionary wrong-headedness would typically make the kangaroos an easy target for human hunters. Fortunately, the local Moni people regard dingisos as ancestors and do not hunt them, even though the kangaroos can be coaxed from a tree with a handful of succulent leaves and a noose easily slipped around their neck. When they encounter human beings, dingisos wave their arms in the air and whistle like pie-eyed new-rave devotees in New Cross, and the Moni view this as a greeting from their ancestors. Sounds like a partnership made in heaven for the Moni and the dingisos.

Evolving in a land without other mammals, tree kangaroos fill the niches generally taken by monkeys. And their commitment to this must be viewed with some respect. Fitting huge hind legs developed for bounding across open plains up a tree is not easy. Dingisos have, however, readapted to life on the ground, whereas other tree kangaroos have shorter hind legs and very long tails, the reverse is true of these lovely black and white fellows. Their striking pied fur is very dense, an adaptation to their life at high altitudes where the temperature can drop to below zero most nights. I salute these weird critters: the black and white, new rave, ground-tree kangaroos.

Animal of the Week -- April 30, 2007

2007-04-30T21:26:00.000+01:00

AOTW Ovis aries (domestic sheep)

The Japanese Poodle Fleece a poem by Peter Hayward age 28 and 3/4

In Japan, we were told, by the tabloid fold
that sheep are poorly known
And that a poodle would vend for a great many yen
If properly clipped and mown

Spotting a scam, an unscrupulous man,
reported the Sun and Express,
trimmed a woolly white sheep to have pom pom feet
for a Japanese star actress

For twelve-hundred pound she bought her hound
so she thought, so rare and so fine
But of the Pedigree Chum her dog would eat none
Since its tastes were distinctly ovine

The rogue we are told, went on and sold
Pets to geishas and makers of noodles
For each one in turn a tidy profit he'd earn
As he was passing off sheep as pet poodles

The fabled actress found her "dog" in distress
As long toenails impinged on its moves
When she went to the vet, a surprise he did get
"These are not claws, they are hooves!"

The papers report that the rogue was then caught
And put in a cell with a lock
Those who were duped, got back their loot
And the sheep were returned to the flock

But the next day it is stated the tale was fabricated
Not a word of the story was true
Never there was a sheep dressed as a dog
Not a ram, not a lamb, not a ewe

Even though it was fake, the story was great
Spreading grins from ear to ear
And if you're a dog or a sheep, expensive or cheap
They'll eat you both up in Korea

*I would like to say sorry for any racial stereotyping/myth propagation -- I hope no-one takes offence and sincerely apologise if you do*

Robins not nightingales -- non AOTW

2007-04-25T07:19:00.000+01:00

Picture this, London 1998, in my second year as a Zoology student at UCL I lived in the delightful NW area of Kilburn, it's delightful now with many nice bars and eateries and the marvellous music venue The Luminaire, it wasn't so nice then, and even worse to the north, appropriately up Shoot Up Hill, was the borough of Cricklewood -- or gangster and skag central as it was then.
One night, on may way back from, erm, some late night study, I fell asleep on the night bus only to wake up in the aforementioned Cricklewood. Now, it was late, buses were infrequent, and I was, erm, confused. My failsafe way to navigate home was by the sound of birdsong because there was a robin that sang all night outside my window.
The clear light of day made me realise that this was a foolish thing to have done as there must have been thirty or more robins along my walk home, nonetheless, the clear light of day found me curled up in my bed. For I had successfully navigated home by the sound of the robin's song.
Thank god for noise pollution during the day, for this is the latest explanation for why robins sing throughout the night. Many people think it is nightingales, but you only get them in Berkley Sq, they are too posh for elsewhere in London.

Sumatran Rhino on Borneo -- not AOTW

2007-04-24T07:03:00.000+01:00

Well, you know what, I am going to start doing this more often. Seems silly that that crazy rhino story is announced and I can't comment until Monday. So, it may still be AOTW next week, it may not be, but here is a link to that video of the Borneo subspecies of Sumatran rhino (Dicerorhinus sumatrensis harrissoni -- eastern Sumatran rhino).
As editors at The Lancet will know, Sumatran rhinos are the hairiest of all the rhinos. Even these erudite and learned folks may not know that these rhinos are the closest living relatives of the woolly rhinoceroses that inhabited Eurasia during last ice age.

Animal of the Week -- April 23, 2007

2007-04-23T16:59:00.000+01:00

Happy Saint George's Day Ani-freaks!

What did you have for breakfast this morning? Perhaps you had some muesli with dried raspberries and strawberries in it, perhaps you had some wholewheat cereal with soy milk, perhaps you had some toast and honey, you might also have popped some bee pollen to take on it's putative benefits, or have you moisturised with a royal jelly face cream, or maybe you even did a little polishing with beeswax (don't you ever say that I don't know my audience). Well, if so, you should spare a thought for this week's animal of the week and cherish the experience, because, it is a tough time to bee Apis mellifera (western honey bee).

Having been ravaged by the vampire mite Varroa for the past 20 years or so, the primary pollinators of apples, soft fruit, beans, and many wild flowers are now facing new threats. Across the USA and Europe, beekeepers have anticipated the waking of their hives, but up to 60% have remained silent, and under investigation have turned out to be ghost hives, food in the cells, young bees abandoned, but no sign of the adults. No one knows the cause of this Colony Collapse Disorder (CCD), although pesticides, GM crops, global warming, and even electromagnetic radiation have been proposed as possible causes. To test the last of these theories a US scientist placed base units for cordless phones in beehives and found that the radiation from them stopped bees navigating home. He also found answering the phone a painful experience and that there was a terrible buzz on the line. Although he never forgot where he left the handset.

And as CCD sweeps the USA and Europe, Europe's bees face another new threat, Vespa velutina, the Asian hornet. At 4 and a half centimetres long and with a wingspan of 6 centimetres, this hornet has swept across France since being introduced a couple of years ago. A group of 30 hornets can kill 30 000 bees in a few hours, biting them in half and stinging them with their powerful toxins. They leave a pile of bisected bees at the hive entrance and plunder the honey bee larvae to take back to their own for dinner.

Our western bees could learn a thing or two from their Asian cousins, Apis cerana. Threatened by a hornet, a group of bees cluster around the giant hornets creating a ball and start to vibrate. The vibrations which they normally use to regulate temperature in the brood chambers can raise the temperature of the bee ball to 46 degrees centigrade and cook the hornet at the centre. Neat, eh?

So, it's not good news for western honey bees right now. Stockpile honey and don't expect bumper crops of many of your favourite summer fruits.

See this video for the outcomes of hornet attacks on European bees and Asian bees (Bees 1, Hornets 1):

It bee mighty entertaining.

Animal of the Week -- April 16, 2007

2007-04-16T16:44:00.000+01:00

The observant among you will have noticed the absence of Animal of the Week last week. For this I am terribly sorry, I was busy with Easter and then the internet went off-line all over the world.

To recompense for these events beyond my control, this week's animal is a monster, or rather a DINOSAUR! YAY! And not just any old dinosaur, oh no, for this week's animal is the king of the dinosaurs Tyrannosaurus rex.

I received a concerned message a couple of weeks back about the discovery of soft tissue in a T rex bone. Did that mean they had DNA? Were we going to start cloning T rex? Now, I had heard nothing of this, but a little investigation turned up that during a 2005 excavation a T rex bone had been broken and inside there appeared to be some soft tissue. Researchers originally assumed that the soft tissue was some weird mineral structure, because actual biological molecules could not possibly survive more than a million years let alone the 68 million years since the T rex had died. Or could they?

This week, the journal Science revealed a partial sequence of a protein from T rex bones found at the Hell Creek formation in Wyoming and Montana. Showing that biological molecules can survive for enormous lengths of time. When compared with other sequences of the same protein for living animals, the T rex was most similar to chickens.

T rex was alive as the reign of the dinosaurs came to an end, 67 million years ago. At 13 metres long and 5 metres tall it was one of the largest land predators to have ever lived. But not the largest. That record currently belongs to Giganotosaurus, which was likely almost 2 m longer and perhaps a tonne heavier than T rex, which lived some 30 million years before T rex in South America. The size of these huge carnivores means that they may not have been the swiftest of creatures, which makes people think they may have been scavengers rather than hunters. However, their prey were likely huge and even slower, so a lack of speed, agility, and grace would not have been necessary; however, they certainly weren't born to boogie.

But anyway, what with all this protein, might we be cloning T rex into chicken eggs any time soon. Unlikely, the protein is probably more stable than the DNA that would be needed for cloning, and even that was in tiny fragments. So sadly, there won't be theme parks populated by dinosaurs and offering T rex rides any time soon, but given their similarity to birds shown by this study, you might like to ride a white swan instead.

NB, the attached image is of course completely inaccurate, I am sure you don't need me to tell you that T rex would not have been able to stand upright as its hips and neck would have dislocated. They would have stood with their backs parallel to the ground.

Animal of the Week April 2, 2007 -- Troglobites

2007-04-02T16:34:00.000+01:00

Hello,
For a change, this week's animals are unnamed. Not because I am being lazy, I am not in charge of that sort of thing, rather because I can't find the names of any of them, and they are five species! They are the five species of troglobite that have caused the Western Australia Environmental Protection Agency to halt the construction of a multibillion dollar mine at Pannawonica, in the north-western region of Pilbara.

You would be forgiven for thinking that troglobite is just another of my gross spelling errors that litter these mailouts like rare insect species over a planned development site, but no, I mean neither troglodyte nor trilobite, but troglobite: any animal adapted to live solely and exclusively within caves that can never leave. Troglobites typically have advanced senses of touch and smell but a massively reduced sense of sight, with most being totally blind. A common adaptation among troglobite spiders, such as those in those in question here, is the loss of eyes and the adaptation of the front pair of legs to become long feelers (as seen in the picture).

The troglobites halting the Robe River, a subsidiary of Rio Tinto, planned mine are spider like creatures, none bigger than half a centimetre in length, but unique to the site and not found in a neighbouring reserve protected from mine exploration. Troglobites feast on traces of organic material that drift into cave systems from the world above or algae and other microorganisms that survive within their cave systems, or in the case of spiders, other troglobites. Unable to survive exposure to direct light as they have no protection against UV rays, these troglobites would have no hope of colonising a new cave system. Every time a cave tropical system is investigated, a new set of these creatures is discovered, fish, salamanders, crickets, centipedes, insects, and shrimps have all several times moved into subterranean homes.

With iron ore set to run out in their existing mines in Australia in the next five years, Robe River will appeal hard for the mines to be built. So these spiders may not be long for this world, so I salute you little nameless, eyeless buddies. Enjoy what time you have left licking algae from the rocks and eating blind beetles in your tiny sunless world.

Animal of the Week March 26, 2007 -- Beautiful punctuation

2007-03-26T07:55:00.000+01:00

Regular readers of the animal of the week mailout, particularly last week's effort, may be surprised to discover that I was once, and to most intents and purposes (earning money while I study to become a taxonomist) still am, a copyeditor. In recognition of the fact that I do not always create the most grammatically pleasing of emails, this week's animal of the week is Polygonia c-album (comma).

A comma is a beautiful butterfly of Europe, Asia, and north Africa. Orange and brown on the upper side of the wing, with wings folded, a brown underside with a small white mark resembling a comma (hence the name) is revealed. The wings have a crinkled edge so that the adults resemble a fallen leaf. The caterpillars are brown with a white mark on their posterior so that they resemble bird droppings. Now that's camouflage.

Anyway, bad punctuation, misspelling, appalling puns, abject failure to inject humour or fact into a supposedly entertaining and informative mailout, I am guilty of all of these things. But at least I did not insert unnecessary hyphenation into the scientific name of a species named after a punctuation mark... never rely on a taxonomist for a joke.

Animal of the Week March 19, 2007 -- New leopard

2007-03-19T17:37:00.002Z

Well, it's fast turning into mammal of the week around here, I was very much going to not have a mammal as animal of the week, but then a new species of beautiful big cat is named, so this week's animal of the week is, of course, Neofelis diardii (Bornean clouded leopard).

Clouded leopards are members of the group of big cats including snow leopards, tigers, leopards, lions, and jaguars, although they are generally thought to be the cats that diverged from the others in this group earliest. Previously the cats on Borneo and Sumatra were thought to be a subspecies of the Neofelis nebulosa, but genetic studies suggest that they diverged from the mainland cats over 1 million years ago when they spread out into the Malay archipelago before it was divided by the sea, and they are distinct enough to have species status themselves.

Although the clouded leopards are small big cats, on Borneo they are the largest predator, on Sumatra, the few tigers that remain put them firmly into second place. Despite their diminutive stature they are finely honed predators and along with jaguars, they have, relative to their body size, the strongest bite of the big cats. Clouded leopards also have the longest canines relative to body size. What all this means, I know not.

Should you be faced with having to tell the two species of clouded leopard appart and you do not have the facility to sequence their mitochondrial genes, the Bornean clouded leopard is much darker than the mainland species and has spots within its cloudy markings. It will also be on Borneo and Sumatra and not on the mainland.

So there you go, what does this new speices status mean? It means more funding for conservation efforts, and more awareness for plight of Borneo's forests threatened by the lumber and palm oil industries. And what does that mean, that means that maybe this isn't really a separate species at all, just a subspecies as previously thought, raised in status by duplicitous conservationists. It all depends whose side you're on really.

Animal of the Week March 12, 2007 -- Come to the tea party

2007-03-12T17:51:00.000Z

So, as it is now March, this week's animal of the week is Lepus europaeus (european or brown hare). The March Hare, a sartorially elegant guest at the famed tea party of Lewis Carroll's Alice's Adventures in Wonderland. Brown hares rarely, if ever, wear jackets or, for that matter drink tea. Rather, they bomb around the fields of northern Europe and western Asia as speeds of 70 kilometres per hour.

At this time of year, you may well see hares careening around meadows, leaping over one another, and engaging in the famous boxing behaviour. Although for many years, people believed these sparring couples were males competing for access to females. But turns out, that they are females fending off unwanted attention too early in the breeding season. When the females are ready, they stop boxing, go at it like rabbits (not very often, just quite similar in shape and mechanics), and a few weeks later they give birth to their young, leverets, in a small hollow or flattened patch of grass, a form, on the surface, not in a burrow.

Keeping a low profile for the main part of the year, their sudden appearence in spring and mysterious habits for the remainder of the year mean that hares have featured prominently in European folklore and religions. The pre-Christian English goddess Eostre whose festivals were celebrated in Spring, could transform herself into a hare, that is if she ever existed, and wasn't a creation of the Venerable Bede's. The association of hares with Eostre's festivals and with the Ostara festival in pagan Germany may be the origins of the Easter bunny.

Maybe they ain't. The phrase "mad as a March hare" was widely used in Lewis Carroll's time, the earliest written record is in John Heywood's 1546 collection of proverbs. Heywood may have mis-spelled his name, but he collected a great many pithy sayings: "While the sun shineth, make hay", "lve me love my dog", "This hitteth the nail on the head", and "All is well that ends well" among them.

Animal of the Week February 26, 2007 -- like a little baby human with bloodlust and hair

2007-02-26T08:05:00.000Z

Well Chaps,

The whole colossal squid thing is so 2005 (http://animal-of-the-week.blogspot.com/2005_09_01_archive.html), so with the discovery of stone age tools and more recently a manufactured spear, I have no choice but to make this week's animal of the week Pan troglodytes (chimpanzee).

The discovery of 4000 year old anvils and hammer stones and traces of smashed panda nuts in Ivory Coast reported in Proceedings on the National Academy of Science a couple of weeks back, was a fantastic finding—it appears that when most humans were getting to grips with stone tools and agriculture, the chimps were developing ballet... they had a nutcracking suite.

No? Alright.

This week, it emerges that US scientists in Senegal have witnessed a chimpanzee making and using a spear to kill a bushbaby. Well known for fishing for termites with thin sticks and hunting monkeys in troops. This is the first time that a non-human animal has been observed making and using a tool to hunt for meat. The female took a thin branch, appeared to work one end to a point with her teeth, then jabbed it into a hole in a tree. At first the researchers though she was trying to fish out a beetle grub, but after a few stabs, she broke through to the hollow in the tree and pulled out the well and truly stabbed body of a bush baby. Although successful hunting was observed only once, researchers say several females were seen attempting to hunt in this way.

Now, most hunting by chimpanzees is done by the males, but most tool use by females. Anthropologists reckon that this discovery suggests that females might have also been integral to the development of tool use for hunting in human evolution too. Interestingly, these particular chimps live in savannah mosaic habitat, similar to that in which the human lineage is first presumed to have broken away from that of chimpanzees.

Perhaps, the ancestors of chimps and humans also used tools and that both species have inherited this same behaviour. Personally, I reckon the behaviour has evolved indepedently, if the chimps had really been using these sorts of tools for the past 5-8 million years, why haven't they got to a more advanced stage with it? 2.5 million years ago species of Homo were crafting bone tools and stone axes: have the Pans really not progressed beyond sticks and flat stones in all that time?

Mind you, give them time, and I can see this going the way of humans: it just seems natural that the females should send their tools out hunting. Girls, you know what I'm talking about (obviously that needs to be delivered by a large American lady on a housewife-oriented daytime show).

Sorry, I'm way off the mark this week.

Animal of the Week February 12, 2007 -- Funny little frog in your throat

2007-02-19T07:57:00.000Z

Happy Chinese New Year! I have already done pigs, look http://animal-of-the-week.blogspot.com/2005_03_01_archive.html, there they are.

So this week's animal of the week is not inspired by the Chinese zodiac. Rather, it is Rheobatrachus silus (platypus frog, southern gastric brooding frog). This tiny Australian frog sadly is no longer with us, but until the early 1980s the Blackall and Conondale Ranges in Southeastern Queensland, Australia, rang with the chirruping of thousands froggies going a courting. Small, green, and quite froglike, they would be unremarkable but for their novel approach to reproduction.

Once her clutch of eggs was fertilised, the female would proceed to eat them. But rather than being dissolved by stomach acids, a compound secreted by the eggs switched off the female's normal digestive function and there the eggs developed. Tadpoles then hatched from the eggs and developed into little froglets. The female could not eat while brooding her offspring and her stomach would swell to fill nearly the entire body cavity, to accomodate the froglets. When the young had developed into fully formed little frogs, the female then would vomit up her children ("midwife, can I have a glass of water, I have a froglet in my throat")!

If surprised or threatened, the gravid female could vomit up her young at any time, and the young could mature successfully outside of the body. Although they laid about 40 eggs, only 20 or so young would ever hatch, perhaps the earlier eggs were digested and were sacrificed in order to switch off the usual gastric machinations, or perhaps the tadpoles and froglets used them as a source of food whil confined to the maternal belly.

I am not the only person captivated by these bizarre things, I found this on a site dedicated to refuting evolutionary science with the argument of irreducible complexity. Although it is an old piece, there argument is slightly undermined by the last sentence of the first para, the frogs have not been seen since 1981 and are listed as extinct by the IUCN.

http://www.darwinismrefuted.com/irreducible_complexity_09.html

"The miraculous reproduction system of Rheobatrachus silus explicitly invalidates the theory of evolution, since the whole system is irreducibly complex. Every step has to take place fully in order for the frogs to survive. The mother has to swallow the eggs, and has to stop feeding completely for six weeks. The eggs have to release a hormonelike substance to neutralize stomach acids. The addition of the extra protein-rich yolk to the egg is another necessity. The widening of the female's oesophagus cannot be coincidental. If all these things failed to happen in the requisite sequence, the froglets would not survive, and the species would face extinction [PH: face it, they're looking at it's rear view].

Therefore, this system cannot have developed step-by-step, as asserted by the theory of evolution. The species has existed with this entire system intact since its first member came into existence. Another way of putting it is, they were created."

Not really a believer in that view myself, but I'll leave y'all to make up your own minds.

Ciao!

Peter Hayward
Head Keeper
Animal of the Week

Animal of the Week February 12, 2007 -- Bird-eating bats

2007-02-12T13:50:00.000Z

This week's animal of the week is the most large of all the bats that live in Europe and the only bat in the whole world that catches birds in mid-air. For this week's animal of the week is Nyctalus lasiopterus (greater noctule bat).

50 g in weight and a wingspan of 45 cm might not seem that big, but compared with Europe's other scrunchy faced insect guzzling flying furballs, most of which are no bigger than a ping-pong ball, the greater noctule is a gargantuan bat. And insects do not quite satisfy their giant appetite.

Fortunately for the greater noctule bats, they live on migratory routes of small brown songbirds such as wood warblers. The wood warblers and the like think they are being smart by flying at night and avoiding the birds that might otherwise try to snaffle small flying things. But the world's only known mammalian aerial predatory carnivore has a different idea. Scientists investigating these leatherwinged beasts have found a large amount of feather remnants in their droppings, especially during the autumn migration when the number of birds passing through is greatest.

Unlike other noctule bats, which are better adapted for forest flying, these are well adapted to open environments and their echolocation is set at a frequency above that audible to the birds they hunt. Clever bats.

Animal of the Week February 05, 2007 -- Philistine fish

2007-02-05T22:22:00.000Z

Good Monday mes petit choufleurs,

It is indeed that time of the week again. And while there have been plenty of animals in the news that I could opt for (turkeys[done], quagga mussels[there's still a couple of cm left in this barrel], and killer whales in Edinburgh), as they say on the internet, meh! This one hasn't been in the news but it (like all the animals) is worth it; this week's AOTW is Epinephelus itajara (itajara, goliath grouper, jewfish).

Goliath groupers are potentially huge reef fish that can be found in the eastern Pacific, the Caribbean, and the west coast of Africa. They can weigh in excess of 400 kg and reach lengths of well over 2 m, although 40 kg is a more typical weight. With their huge gaping mouths and impressive size, they eat pretty much what they like, although lobsters and other large crustaceans form a large part of their diets. In this week's picture, the fish has been placed next to an American to give you some impression of its size.

Most female goliath groupers are small, and most males are large, in fact, all the really large groupers are male. This observations suggests that like other several other species of grouper they are protogynous, that is, they start out their lives as females, and only when they mature or reach a certain size, do they become male. So there are a few very large males. Once a popular food and game fish, the goliath grouper has been protected since the early 1990s and is globally critically endangered. Where they are plentiful goliath groupers can still be caught. Although they are best approached with caution: a spear fisherman was dragged into a cave and drowned by a large one last year.

In 1991, the American Fisheries Society felt that the name jewfish might be offensive, so they renamed it the goliath grouper after the Philistine champion thwarted by the Hebrew hero in the story from the Old Testament and Qur'an. Perhaps they chose to name the fish after the famous philistine giant because of its size, although I like to think the rebranding is because of the fish's disregard for high-brow culture.

Until next week my dears,

Animal of the Week January 29, 2007 -- Freaky freak shark sighting

2007-01-29T07:29:00.000Z

Hooray, hooray, it's ANIMAL DAY!!

This week's animal is inspired by a rare sighting of a beast washed up from the briny depths: Chlamydoselachus anguineus (frilled shark), which was spotted in the Awashima marine park in Japan a week ago.

Fishermen reported having caught an eel-like creature with razor-sharp teeth, so rarely are these seen in surface waters they had no clue what it was. The shark died a few hours after being identified. Frilled sharks typically live at 120 m to 1280 m down and feed on squid, other sharks, and deep-sea fish. The individual sighted was likely ill, hence the death, and disoriented.
Their fierce looking W shaped teeth are, like those of all sharks, replaced from behind in a continuous conveyer belt of piscine death. Although at only 2 m in length (and at 120 m below the surface) humans have little to fear. Also like many other sharks, they are oviviparous—their eggs incubate and then hatch internally right before the pups are born, they have 2–12 pups at a time.

One of the oddities of the shark world, the one species of frilled shark (or possibly two if the advocates of the South African frilled shark as a species are correct) is in a family all of it's own, in a group comprising the most primitive sharks—the six-gill sharks. Although frilled sharks are that different from the others in this group that they may be even more isolated on the shark family tree.

And why is this cartilaginous monstrosity called a frilled shark? I hear you ask. Because it's gill tissue pokes out of the gill slits, like a herniated lung. Gross.

And look: more you tube http://www.youtube.com/watch?v=8X6GKcLkdRE

Animal of the Week January 22, 2007 -- Pull tiger tail

2007-01-22T07:15:00.000Z

So sorry I'm late again. My zoological and Prisoner Cell Block H knowledge was needed in a pub quiz. Anyhooos, here I am finally embracing the multimedia revolution and sending you a link to a youtube video. Don't get used to it, mind.

Of course, as is the tendency with youtube videos, you have probably already all seen this. Please reply with the phrase "yawn head keeper, yawn" in the subject line if you have. Anyway, this week's animal of the week is a Hylobates lar (white handed gibbon, lar gibbon). Watch the video and you'll see why.

http://www.youtube.com/watch?v=1AZn5nWIj_g

(the soundtrack is awful, I suggest you download something by jerky indie poseurs Pull Tiger Tail and make your own appropriate bed). Quite why the gibbon is behaving like this is a mystery to me. But it certainly looks to be having fun.

Worry not fact fans, the lesson endeth not here. One of 13 species, lar gibbons of Southeast Asia, China, and Indonesia, are pretty standard gibbons: about 5.5 kg, at home in the treetops, rarely on the ground, and monogamous. Although they typically mate for life, pairs sometimes divorce; and even more saucily, females in estrus sometimes sneak across to another pair's territory and have it away with a different male.

Cheeky gibbons!

Celebrity a-like: Andrew Marr 50% (it's in the arms)
Top speed: 10 mph
Tenacity: 4
Likelihood of hurting The Feeling: 35%
Aesthetically pleasing: 5
Violence: 3
Can be kept on a roof terrace: 1
Religiousity: 5
Special skill: Brachiating 80

Peter Hayward
Head Keeper
Animal of the Week

Animal of the Week, January 15, 2007 -- The early bee catches the erm... cold

2007-01-15T10:37:00.000Z

While AOTW is vetoing birds, this week’s animal would be rather apposite, if only the sighting of two Bombus terrestris (buff-tailed bumble bees) in early January was not completely wrong! Get me the Bill on the phone.... no, not the police, Bill Oddie! For like frozen frogspawn in February or migrant martens in March, this is an early sign of Spring, which make the airing of the TV Springwatch in May rather redundant.

Clearly a sign of global warming and harbinger of impending extinction of polar bears, I shall not dwell on inevitable meteorological catastrophes. Instead, let us big up the bee! Buff-tailed bumble bees are the UK ’s largest bee, the queens (as they were that I saw) being about 2·5 cm in length (taller if you include the size 45 stilettos and Dusty Springfield bouffant wig -- queens see, boooom boooom).

Mated queens go into hibernation at the end of autumn when the frosts arrive, emerge in early spring (spring, not January… foolish bees), gather some pollen and nectar and start colony. Once she has bred a few worker daughters, the queen gives up foraging herself and becomes and egg laying machine, the colony grows throughout the early summer. Towards the end of the summer, the queen lays some unfertilised eggs that will develop into the males (drones) and some fertilised eggs that will become the new queens. As autumn ends, the breeding animals leave the nests and mate, then when the frosts arrive, all the workers, drones, and old queens die.

The queens and worker females have stings, but the drones don't. And if you leave bees alone, they are most unlikely to sting you.

If you spot any bees about over the next couple of weeks, call them silly bees and send them on their way, pitying their crazy buff tails, which will likely be frozen dead in a couple of weeks. Global warming, eh?

Number of legs: 6
Celebrity a-like: Bea Arthur 30 (queens score highly, others low)
Top speed: 10 mph
Tenacity: 4
Likelihood of hurting The Feeling: 65%
Aesthetically pleasing: 5
Violence: 2
Can be kept on a roof terrace: 30
Religiousity: 15
Special skill: Buzzing 80

Animal of the Week January 8, 2007 -- The slug it's ok to love

2007-01-08T19:02:00.000Z

Belated Happy New Year,

Having pelted you with fowls in the extreme before Christmas, I made the sole new year's resolution of not touching any birds for the first few weeks of 2007, I am sure you can imagine how difficult that is going to be for me.

I must thank Doug for this week's animal of the week, he drew it to my attention some weeks back and, while I don't take requests, it is such a beautiful and crazy thing, that I really have no choice. When people ask me "What's your favourite animal?", I tend to reply "I like all the animals equally, except slugs, I don't really like slugs" (I am sure this would be to the horror of my niece, who, to the dismay of her mother, is well into slugs). But then, perhaps I should reconsider in the light of this week's animal, Glaucus atlanticus (blue sea slug).

This amazing looking creature isn't actually that closely related to land slugs, although it is a gastropod mollusc (like slugs, snails, limpits, that sort of thing) which is essentially a layer of organs sat atop one big long foot. Although in the case of the blue sea slug, the organs are not above the foot but below it, for this topsy turvy nudibranch floats upside down at the surface of the oceans with its beautifully patterned foot pointing to the sky. And what does this 4 cm long sci-fi-alike do there? Drifts around gobbling up Portuguese man-of-wars (definitely not jellyfish), one of the most stingy creatures in the sea.

While most animals are put off tackling Portuguese man-of-wars by their thirty foot long tentacles covered in some of the most vicious stings in the animal kingdom, blue sea slugs are immune to these defences and, in fact, assimilate the most potent stings into a special sack. Unwary beachgoers who happen upon one of these and choose to fiddle with it may find themselves being stung worse than if they rubbed a Portuguese man-of-war on themselves, because the slugs take on only the strongest stings.

Crikey blimey governors, I hope you agree that the upside down, floating, stinging, beast eating blue sea slug, is a most worthy first animal of the week for 2007.

Number of legs: 0
Celebrity a-like: A smurf 40
Top speed: 4 mph
Tenacity: 7
Likelihood of hurting James Blunt: 40%
Aesthetically pleasing: 10
Violence: 2
Can be kept on a roof terrace: 1
Religiousity: 5
Special skill: Stinging 80

Animal of the Week December 18/25, 2006 -- Deep breath, and all together everyone

2006-12-20T16:19:00.000Z

On the first day of Christmas,
my true love sent to me
A partridge in a pear tree.
(The word “fart” is derived from the Greek for partridge [Perdix perdix] “perdix”, partridges make a whirring noise when they fly)

On the second day of Christmas,
my true love sent to me
Two turtle doves,
And a partridge in a pear tree.
(Not called a turtle dove [Streptopelia turtur] because it has a shell, it doesn’t; the name comes from the soft cooing “turr turr” call)

On the third day of Christmas,
my true love sent to me
Three French hens,
Two turtle doves,
And a partridge in a pear tree.
(Alsace, Aquitaine, maran, combattant du nord, coucou du Rennes, crevecouer, pictave, Lyonnaise… these are some French hens [Gallus gallus domesticus])

On the fourth day of Christmas,
my true love sent to me
Four colly birds,
Three French hens,
Two turtle doves,
And a partridge in a pear tree.
(Not “calling birds”, my friends, but “colly birds”, colly=coaly=black, yes, Blackbirds [Turdus merula], that what the true love gives 36 of in this song, enough for a pie and a half)

On the fifth day of Christmas,
my true love sent to me
Five golden beetles,
Four colly birds,
Three French hens,
Two turtle doves,
And a partridge in a pear tree.
(Gold beetles [Plusiotus resplendens] are very gold but not ringshaped at all…. Clutching at straws my friends, clutching at straws)

On the sixth day of Christmas,
my true love sent to me
Six geese a-laying,
Five golden beetles,
Four colly birds,
Three French hens,
Two turtle doves,
And a partridge in a pear tree.
(Domestic geese are derived from greylag geese [Anser anser], these geese frequently form same-sex pairs that engage in courtship behaviour and territorial disputes, up to 10% of pairs, these couples may act as guardians of the flock—gaylag geese more like)

On the seventh day of Christmas,
my true love sent to me
Seven swans a-swimming,
Six geese a-laying,
Five golden beetles,
Four colly birds,
Three French hens,
Two turtle doves,
And a partridge in a pear tree.
(Since the 12th century, all the mute swans [Cygnus olor] on the Thames have been owned by the British Monarch (these swans have no rings), except, that is, for those owned by the Dyers’ company (ringed on one leg) Vintners’ company (ringed on both legs))

On the eighth day of Christmas,
my true love sent to me
Eight maids a-milking,
Seven swans a-swimming,
Six geese a-laying,
Five golden beetles,
Four colly birds,
Three French hens,
Two turtle doves,
And a partridge in a pear tree.
(The most common dairy cow [Bos taurus] is the Holstein-Friesian; 9 million of the USA’s 10 million dairy herd are this breed. A single cow can produce 10 000 litres of milk a year in the USA where hormones are used to up milk production, but only 7000 to 8000 litres in the UK. Artificial insemination is the norm for dairy herds, meaning a few bulls can father entire generations of calves – the most prolific (200 000 calves) producer of bull-juice of all time was called… Starbuck)

On the ninth day of Christmas,
my true love sent to me
Nine lady beetles,
Eight maids a-milking,
Seven swans a-swimming,
Six geese a-laying,
Five golden beetles,
Four colly birds,
Three French hens,
Two turtle doves,
And a partridge in a pear tree.
(The theory goes that ladybirds are so-called after Our Blessed Lady, the mother of Jesus for their ability to save crops from pests!)

On the tenth day of Christmas,
my true love sent to me
Ten Lord Howe woodhens,
Nine lady beetles,
Eight maids a-milking,
Seven swans a-swimming,
Six geese a-laying,
Five golden beetles,
Four colly birds,
Three French hens,
Two turtle doves,
And a partridge in a pear tree.
(The restoration of the population of the Lord Howe woodhen [Gallirallus sylvestris] from 20 individuals in 1969 to 200 birds now by captive breeding and elimination of pigs from the small Island off the east coast of Australia is seen as a model for successful conservation)

On the eleventh day of Christmas,
my true love sent to me Eleven pipefish piping,
Ten Lord Howe woodhens,
Nine lady beetles,
Eight maids a-milking,
Seven swans a-swimming,
Six geese a-laying,
Five golden beetles,
Four colly birds,
Three French hens,
Two turtle doves,
And a partridge in a pear tree.
(In pipefish, such as the ornate ghost pipefish [Solenostomus paradoxus], as in their relatives seahorses, the male assumes the main parenting role, wither carrying the eggs around on specially adapted skin or in a pouch.)

On the twelfth day of Christmas,
my true love sent to me
Twelve drummers drumming,
Eleven pipefish piping,
Ten Lord Howe woodhends,
Nine lady beetles
Eight maids a-milking,
Seven swans a-swimming,
Six geese a-laying,
Five golden beetles,
Four colly birds,
Three French hens,
Two turtle doves,
And a partridge in a pear tree!
(Animal was the drummer for the Muppet band, Dr Teeth and the Electric Mayhem)

Partridge
Number of legs: 2
Celebrity a-like: The Partridge family 26
Top speed: 50 mph
Tenacity: 2
Likelihood of hurting James Blunt: 64%*
Aesthetically pleasing: 6
Violence: 2
Can be kept on a roof terrace: 24
Religiousity: 32
Special skill: Edibility 76

*James Blunt (né Blount), shooting accident?

Turtle doves
Number of legs: 2
Celebrity a-like: Teenage mutant ninja turtles 12
Top speed: 40 mph
Tenacity: 2
Likelihood of hurting James Blunt: 12%*
Aesthetically pleasing: 7
Violence: 2
Can be kept on a roof terrace: 24
Religiousity: 24
Special skill: Cooing 62

*There is always hope

French hen
Number of legs: 2
Celebrity a-like: Foghorn Leghorn 76
Top speed: 20 mph
Tenacity: 2
Likelihood of hurting James Blunt: 22%*
Aesthetically pleasing: 4
Violence: 2
Can be kept on a roof terrace: 31
Religiousity: 45
Special skill: Edibility 92

*Salmonella

Colly birds
Number of legs: 2
Celebrity a-like: Cilla Black 3
Top speed: 25 mph
Tenacity: 2
Likelihood of hurting James Blunt: 3%
Aesthetically pleasing: 6
Violence: 2
Can be kept on a roof terrace: 2 (not pets, but they might visit!)
Religiousity: 21
Special skill: Birdsong 75

Golden beetle
Number of legs: 6
Celebrity a-like: Goldfrapp (Allison) 1
Top speed: 4 mph
Tenacity: 3
Likelihood of hurting James Blunt: 2%
Aesthetically pleasing: 7
Violence: 1
Can be kept on a roof terrace: 23
Religiousity: 47
Special skill: Being a golden 78

Greylag goose
Number of legs: 2
Celebrity a-like: Anthony Edwards 21
Top speed: 50 mph
Tenacity: 4
Likelihood of hurting James Blunt: 2%*
Aesthetically pleasing: 6
Violence: 3
Can be kept on a roof terrace: 2
Religiousity: 18
Special skill: Roast potatoes 89 (see Nigella)

*As if Blunt is a member of the “Goose club” (see AOTW 04/12/06)

Mute swan
Number of legs: 2
Celebrity a-like: Cate Blanchet (the most swanlike person I could think of) 15
Top speed: 50 mph
Tenacity: 4
Likelihood of hurting James Blunt: 76%*
Aesthetically pleasing: 8
Violence: 4
Can be kept on a roof terrace: 2
Religiousity: 58
Special skill: Breaking arms with a wing 67
*Break his arm with a wing, natch

Cow
Number of legs: 4
Celebrity a-like: Princess Di (it’s in the eyes) 33
Top speed: 30 mph
Tenacity: 3
Likelihood of hurting James Blunt: 46%*
Aesthetically pleasing: 5
Violence: 3
Can be kept on a roof terrace: 1
Religiousity: 80
Special skill: Kobe beef 89 (yumski)

*I persuade James Blunt to don a dog suit and tell the cow with the crumpled horn that James Blunt killed the rat that ate the malt that lay in the house that Jack built.

Ladybird
Number of legs: 6
Celebrity a-like: Spottyman from Superted 25
Top speed: 4 mph
Tenacity: 3
Likelihood of hurting James Blunt: 14%
Aesthetically pleasing: 7
Violence: 2
Can be kept on a roof terrace: 67
Religiousity: 8
Special skill: Eating aphids 72

Lord Howe woodhen
Number of legs: 2
Celebrity a-like: Geoffrey Howe 12
Top speed: 18 mph
Tenacity: 2
Likelihood of hurting James Blunt: 12%
Aesthetically pleasing: 5
Violence: 1
Can be kept on a roof terrace: 16
Religiousity: 1
Special skill: Endemism 86

Ornate ghost pipefish
Number of legs: 0
Celebrity a-like: Michael Fish 1
Top speed: 2 mph
Tenacity: 2
Likelihood of hurting James Blunt: 10%
Aesthetically pleasing: 8
Violence: 1
Can be kept on a roof terrace: 2
Religiousity: 2
Special skill: Looking like coral 78

Animal
Number of legs: 2
Celebrity a-like: Animal 100
Top speed: 14 mph
Tenacity: 5
Likelihood of hurting James Blunt: 67%*
Aesthetically pleasing: 3
Violence: 6
Can be kept on a roof terrace: 50
Religiousity: 18
Special skill: Drumming 69

*Drumstick in the eye, biting, that sort of thing, especially if Blunt tries to sing

Animal of the Week December 11, 2006 -- Top trumps start here

2006-12-11T19:34:00.000Z

Well, 11 doors (okay okay, 12) open on the advent calendar, and what was it today...

Little Equus asinus (donkey), little donkey on the dusty road
Got to keep on plodding onwards with your precious load
Been a long time, little donkey, through the winter’s night
Don’t give up now, little donkey, Bethlehem’s in sight
Ring out those bells tonight
Bethlehem, Bethlehem
Follow that star tonight
Bethlehem, Bethlehem
Little donkey, little donkey had a heavy day
Little donkey, carry Mary safely on her way

You may be surprised that I have not plumped for one of those deep-sea species all over the news like a bad case of crabs this week... well, they're just not festive enough. But following on from one red-top paper's lead of giving the deep-sea organisms a tenacity score for their ability to hang on to life at the margins of possibility. Here is the first AOTW top trump card! A series that you and your friends can cut out and keep (I'm sensing the must-have gift X mas 2007 here).

Donkey
Number of legs: 4
Celebrity a-like: Alanis Morissette 78
Top speed: 35 mph
Tenacity: 4
Likelihood of hurting James Blunt: 86%*
Aesthetically pleasing: 4
Violence: 4
Can be kept on a roof terrace: (miniature donkeys) 3
Religiousity: Popular in monotheistic religions and Seth of the ancient Egyptian pantheon had a Donkey's head 65
Special skill: Burden 68

*Aroused by the braying sound of Blunt's voice, donkey uses one of his more famous attributes (frequently used in a popular simile [yeah, that's right kids, "kick like a donkey"]) to ensure that Blunt won't be thinking about sitting down at a piano to write songs for a while.

The origins of the word donkey are unknown, but it became widely used only in the 18th century. Perhaps because at that time, pronunciation of the word ass matched that of the word "arse", so the historically more popular word fell out of use to save blushes. Later, pronunciation of ass changed back to the way we know it today, but in American English 'arse' was lost all together and ass became the word for deriere. Donkey might be a diminutive form of the word "dun" (a common donkey colour) and originally pronounced to rhyme with "monkey".

Donkeys feature commonly in the bible, and in many stories mentioning that a man was riding a donkey was to imply wealth, as they were the biblical equivalent of sports cars. Maybe if Joseph and Mary actually had a sports car they'd have got a proper room. The young chap in this week's picture is certainly pleased as punch to own the nippy little model at his side. A miniature donkey!

Computer-game star Donkey Kong was not, in fact, a donkey but earns the moniker due to his stubbornness.

Next Week... Christmas!

Cheers All,

Animal of the Week December 04, 2006 -- Tis the season.... to be eaten

2006-12-04T21:34:00.000Z

And what was on the door of Animal of the Week's advent calendar this morning?

Maleagris gallopavo (turkey). Over 45 million turkeys will have been eaten over Thanksgiving in the US, then just a few weeks later another 22 million will be eaten in US at Christmas, in the UK we’ll get through another 11 million or so… these are tough times for this week's animal.

The popularity of turkey at Christmas and Thanksgiving is actuality a recent addition to harvest and midwinter traditions. The only foodstuffs documented at the Plymouth pilgrims' feast with the Wampanoag in 1621 were venison and waterfowl, Queen Elizabeth favoured goose at Harvest Festival, Americans probably later switched to turkey as they were more abundant. Until the middle of the 1900s turkey was something of a luxury in the UK. In Dickens' A Christmas Carol, when Scrooge has had some festive goodwill spooked into him, he saves the Cratchits from the "goose club" by purchasing a prized turkey for them.

Intensive farming and the development of new double-breasted breeds (large and well-dressed) has made turkeys a popular choice for large family gatherings. Male turkeys, called gobblers or toms, naturally woo females, or hens, by displaying with their bright blue snood (the extendable protrusion above their beak) and wattle, a fanned tail, and elaborate gobbling. Many industrially farmed turkeys cannot mate of their own accord (the toms are lucky if they can walk, let alone gobble) and so the females have to be artificially inseminated. That is, unless they manage to reproduce without mating, as turkeys are want to do. Traditional breeds of turkey resemble more closely their wild North American forebears and are able to breed naturally, walk, run, and fly. They also taste nicer and require less farm trickery to raise them.

Surprisingly nippy, wild turkeys can fly well and can run at speeds of up to 55 miles per hour! They need to. In the southern USA, fried turkey is a popular dish, and a Turkeyfryer has been developed in which a whole bird can be deep fried, I was amused but not surprised to find out about this.

This is turning into a bit of an essay, but I couldn't finish without pondering why an American bird is called turkey. There are several theories about its origins: it's a corruption of the native word, firkee; it's derived from turka, the Indian (Asian sub-continent) name for peacock, the Americas were originally thought to be attached to India; it comes from a tendency for English speakers to name exotic things after exotic places; or perhaps most likely, it was originally thought to be related to the African helmeted guinea fowl (Numida meleagris), which was called a Turkey-cock as it was imported to Europe through Turkey, and so the turkey was also called a Turkey-cock. The name stuck in North America, but when the guinea fowl's origins were better understood, they were renamed. Convoluted I know, but I like it that way.

Animal of the Week November 20, 2006 -- Don't step on my blue suede flippers

2006-11-20T22:34:00.000Z

Hello Ani-freaks

Sometimes, I'd just like to leave you with a picture. And ideally this would be one of those weeks. But then regular readers know that I don't know when to leave well-enough alone.

This week's animal is Eudyptula minor (fairy penguin, little penguin, little blue penguin, or Kororā). The smallest species of penguin is a resident of New Zealand and southern Australia. Rescued fairy penguins in the Antarctic Center in Christchurch, New Zealand, have been spending too much time hanging out on the shingle flexing their wings, rather than swimming in their pool. Their idle posing has led to calluses on their feet, and these natty little daps have been developed along with a regimen of saltwater footbaths to cure their foot injuries in preparation for their return to the wild.

Unendangered, widespread, and a popular tourist attraction, the fairy penguin is one of the luckier animals featured in animal of the week. However, one threat to the fairy penguin is that of rebranding. In April this year, staff at Sea World, Queensland, Australia, were planning to rename fairy penguins as they felt the name might offend gay men... or fairies as they are clearly more popularly known.

Anyway, wouldn't bother this one, look how chuffed it is with its new shoes. Definitely a female.

Cheers all,

Animal of the Week November 13, 2006 -- The witchetty grub eats the witchetty shrub

2006-11-13T23:52:00.000Z

Take the phone off the hook, put down your copy of War and Peace, cancel all appointments you may have for the next few weeks. For, thank the lord, I’m a Celebrity Get Me out of Here is back! Sorry non-UKers, you won’t be able to watch this marvel of televisual entertainment in which ten of our top media figures battle with the elements and the insects with the aim of being crowned king or queen of the jungle. If they succeed they will join such cultural behemoths as Kerry Katona and Joe Pasquale (do you know how hard I find it not to use Pesci instead of Pasquale – now that would be worth watching) on the fast train to Iceland! If they fail, well, it’s a short trip back to obscurity (unfortunately they do come back).

No doubt, at some point over the next few weeks, a squealing nobody will bravely chow down on one of this week’s animals in a bushtuckertrial. For this week’s animal is Xyleutes leucomochla, (cossid moth, witchetty grub). These native Australian delicacies are actually the larvae of any one of several beetle or moth species, but most commonly they’re cossid moth larvae.

Witchetty grubs rather poetically feed on the roots of witchetty shrubs. They grow fat on the sap, storing up energy for a fleeting life as an adult. The moths are the size of sparrows, and the grubs may be 7 cm long and as fat as your finger (if you’ve got fat fingers like me).

Eaten raw they provide tasty snacks with leathery skin, sweet flesh, and a liquid centre (like liqueur chocolates in a sausage skin). If you prefer, you can, in true Australian style, throw them on the barbie—after such treatment they will taste like chicken (of course – what doesn’t?) or prawns with peanut butter. To people survivining in the outback, these larvae can be a lifeline, for TV producers, they're another titilating, humiliating stunt!

So who will end up eating the witchetty grubs? Will it be 1980s newsreader Jan Leaming, Tony Blair’s sister in law Lauren Booth, ex-Joseph Jason Donovan, ex-Footballer’s wife Phina Oruche, or ex-Mr Minelli and current Mr Potato Head David Guest? You’ll just have to watch to find out.

At least we know it won’t be flamboyant designer, Scott Henshall (no me neither), who has said that he will not eat any creepy crawlies; so no doubt the producers will be feeding him the testicles this time – which was probably, after having seen a snippet of him on the show, his thinking all along.

Oh, and this week's picture, there is a witchetty grub in his hand, and well, it's only a matter of time before one of them is on IACGMOOH, right?

I thank you,

Animal of the Week November 6, 2006 -- Roll up, roll up, see the freakshow dolphin

2006-11-07T23:14:00.000Z

In honour of the forefinned and hindfinned, four-finned specimen caught off the coast of Japan this week, animal of the week is somewhat predictably Tursiops truncatus (bottlenose dolphin).

Bottlenoses are some of the largest dolphins and have a worldwide distribution in tropical and temperate waters. They are the typical dolphinarium dolphin, splashing spectators and firing their keepers out of the water for our entertainment in many a water park. But, as you may well have seen for yourself, they generally have only the paired pectoral fins and a dorsal fin.

So, why the bejesus does this Japanese one have four paired fins? Is it part of this highly intelligent species' plan for world domination? Will they be freeing up their forelimbs for the use of weapons of the modern age such as guns, knitting needles, or paparazzo cameras? Can we expect to see a beaky crusader creeping up the street with its sights on our pints any time soon?

Unlikely.* Fortunately for the future of the human race, this aberration is probably caused by the accidental switching on of an ancient gene that did once lead to the development of hind limbs. Believe it or not, dolphins, whales, and porpoises belong to the same group of animals as cows, giraffes, and camels -- the artiodactyls or even-toed ungulates. The closest living relatives of whales and dolphins are hippos; and rather surprisingly, cows, sheep, deer, and giraffes are more closely related to whales and hippos than they are to camels. Some innovative hippo-ish creature took the extra four-legged steps into the ocean about 50 million years ago. The whales and dolphins never looked back, becoming supreme marine mammals and streamlining by losing their hind limbs.

Atavistic features, such as this dolphin's hindfins, are not common, but nor are they unheard of: dolphins and whales with pelvic fins have been found before; and Alexander the Great's horse, Bucephalus, was said to have had additional toes with hooves resembling those of the ancestral horse merychippus. Do human's show atavistic traits, I hear you ask? Well, anyone unfortunate enough to have seen my back in my recent and advancing years will have witnessed, firsthand, evidence of our furry origins.

I thank you,

Peter Hayward
Head Keeper
Animal of the Week

*Just in case any of you sly bastards are reading this, you can keep your fins off my beer, alright.

Animal of the Week -- October 23, 2006 -- See a bird in another bird's mouth

2006-10-30T19:20:00.000Z

Well, it's sawhain again, time to cut up some fishnet stockings, pile on the face paint, perfect walking around your house with the lights off to fool the trick-or-treaters into thinking there's no-one at home, and get a pumpkin ready to drive off the malevolent forces that will try to possess you this Tuesday night.

For many a Londoner, the most despicable creature, surely an instrument of the devil and harbinger of ill is the pigeon. Not that we hate pigeons per se (naturally I don't, I love all the animals), but the abundance, omnipresence, and pestilence of these "rats with wings" is a constant reminder of all that is ill with society. There are a few crazies, probably in cahoots with the dark lord, who think that feeding the toeless, tumour-ridden aves will, in some way, help them. It won't, it will just enable them to breed more quickly and so increase the number of sick birds spluttering, stumbling, and dripping on our polluted city streets. Feed them less, they'll breed less, and a smaller population of birds will be healthier and cleaner.

Anyway, last week, the arrival of an unlikely champion in the battle against the number of pigeons (note, not against the birds themselves) appeared: Pelecanus onocrotalus (eastern white pelican, great white pelican). One of the four eastern white pelicans that inhabit Duck Island in the park's lake was photographed snaffling a pigeon. The pelican held its victim in its beak for about 20 minutes before managing to get the pigeon facing head first for the trip to the pelican's belly. Although pelicans are much better known for their consumption of fish, the head first principle of swallowing scaly finny fish also applies to feathery wingy birds.

Now, there have been great hopes for the return of the peregrine falcon to London, and its role in reducing the numbers of pigeons, but I have seen a peregrine make a kill in London, and what did it kill? It killed an ickle starling. Rubbish, let's get in more pelicans.

There have been pelicans in St James' Park since the Russian ambassador gave some as a gift to Charles II in 1664. In less prescriptive times when the birds' wings weren't clipped, one used to nip up to the Regents Park zoo and steal the fish at feeding time. The flaps of skin from pelicans' bills have been used as tobacco pouches and, even more inventively, as sheaths. Fish, baccy, pigeons, members, and spent semen -- truly, a peculiar bird is a pelican, its beak can hold more than its belly can.

Peter Hayward
Head Keeper
Animal of the Week

Animal of the Week -- October 23, 2006

2006-10-23T22:32:00.000+01:00

Guess who?! That’s right, it’s me! Hiya!

Just a heads up, you have only a few minutes left to buy your Iceland Air all inclusive tickets for the Sugarcubes’ gig in Reykjavik on November 17, 2006—yes, Bjork will be with them (http://www.icelandair.co.uk/home/packages/our-best-deals/detail/store65/item52342/?gclid=CKLMs-PKjYgCFRtNEgodoFROHQ). Of course if you are a fan of this week’s animal of the week, you might think twice about going to Iceland . This week’s animal of the week is the second biggest animal in the whole wide world Balaenoptera physalus (fin or finback whale), that goes in and out of the harbour.

Although it is the fastest species of whale, reaching speeds of 37 km per hour, one hapless individual was not able to outpace the Icelandic whaling boat that was the first to head out on Iceland ’s resurrected commercial whaling enterprise. The 20 m whale was harpooned in the north Atlantic. I said "Ouch! this really hurts".

Iceland, along with Norway, has decided to resume commercial whaling and will take nine fin whales and 30 minke whales between now and next August, even though the International Whaling Commission still bans the killing whales for non-research purposes. Japan continues to capture whales for scientific research. I will shortly be conducting my own scientific research on an egg sandwich. I’ve got to eat something otherwise I’ll die.

Most estimates put the northern hemisphere population of fin whales at about 5000 and the southern hemisphere population at about 1000 and the species is classified as endangered by the Intenational Union for the Conservation of Nature. Icelandic authorities reckon there are may be as many as 20 000. Quantifying the numbers of ocean animals isn’t the easiest thing, but there may not be plenty more whale in the sea. Fin whales grow to 25 m long and maybe 70 000 kg, they dine on tiny krill (very small shrimp-like animals). Indeed, they don’t really like lobster (like lobster).

Of course if you do find yourself in Iceland and you pass a butcher, you may like to make a purchase, and you'll need to know what to do with it:

Joint of Whale Meat Steeped in Red Wine Marinade
6–8 portions:
1 1/4 kg of whale meat
3 dL red wine
1 dL vegetable oil
3 ground cloves
1/2 tsp coarsly ground pepper
2 tsp of salt
The Marinade
3/4 L juices from the meat
Thickening (milk and flour)
4 dessert spoonfuls of sour cream
Sugar
Salt
It may be a good idea to bind the joint to help it keep in good shape. Place it in a small oven dish and pour the marinade over. Leave the joint there until the next day, turning it at regular intervals. Remove the joint from the dish, dry it well and rub it with salt. Cook the joint until it turns a pleasant brown colour all over, turn down the heat, and add water to reach 2–3 cm up the side of the joint, approx. 3/4 L. Let the joint simmer for about 20 min, turn it over and leave it for another 20 min. Measure enough of the juices to make enough marinade, about 3/4 L. Add the thickening to the marinade, and then the sour cream to taste. Serve with boiled beans or other vegetables, and boiled or fried in the pan.

Ahhh, it’s good to be back.

Ta

Peter Hayward
Head Keeper
Animal of the Week

Animal of the Week September 18, 2006 -- The great white hope

2006-09-20T13:22:00.000+01:00

Hello Ani-freaks

Those among you who know me well know that when Sleater Kinney ( US , post-riot-grrl, bassless, les-rock trio) does something, I tend to follow. So when they announced earlier this year they'd be on indefinite hiatus, I saw the future of Animal of the Week. But whereas their's is an indefinite hiatus of probably forever, mine is an indefinite hiatus of 2, 3, maybe 4 weeks, just while I realign my life. So, don't consider this my farewell tour...more of an "au revoir mailout".

And just as this onset of the inter-regnum of AOTW will likely be recorded as a legendary event in the history books, so this week's animal of the week marks a remarkable occurrence, a good omen for all the nations of the world. For this week's Animal is the male white bison born a few weeks back on the Heiders' farm in Wisconsin, USA. In several First Nations religions, typically those of plains tribes, white bison are sacred and considered to have mystical, magical, and healing properties. Lakota Sioux legend has it that PtsanWi (White Buffalo Calf Woman) appeared to two scouts sent to look for food in a time of famine, although she seemed to be a beautiful young woman clad in white, she was really a white buffalo in disguise. One scout tried to embrace her, she turned him into a pile of bones, the other tried to shoot her, but she told him "Don't even bovver me wiv your arrows, I'm a god innit", and then she went and helped out the tribe, gave them some scran, smoked a peace pipe, and taught them music and rituals. Which just goes to show that it's better to threaten a god than to get amorous with one. In another legend, a male white buffalo will be born that will reunite all the nations of the world, turning from white, to red, to yellow, to black, and to brown representing the races of people. Seems like this bull calf is right on time, eh?

This is the third white bison to be born on the Heiders' farm since 1994; the meaning of this birth for many people is quite profound. For cynics, it is a sign that the Heiders' bison have interbred with European cattle.

The American bison (Bison bison) was once the most numerous large mammal species in the world, there were about 100 million of them roaming the prairies and forests of North America in the middle of the 19th century. However, they became an enemy of "progress" for the USA, not only could the massive herds obstruct construction of railways and hold up trains for weeks, but also the Native Americans—who relied on the bison for clothing, food, tools, and housing—could be killed, weakened, and dispossessed by eradicating the bison. At the height of the slaughter (right year, right season), European American hunters may have been killing as many as 100 000 animals per day. Don’t believe me? Check out the pile-of-skulls picture! “ Buffalo ” Bill Cody was said to have killed 100 animals in one session, and one hunter claimed that in his years as a professional he had shot 20 000 bison. By 1890, there were just 200 or so animals—that's 99 999 800 animals killed in about 50 years! Presently there are about 350 000 bison. Only a few hundred purebred animals exist, and the only continuously wild population of purebred bison lives in Yellowstone Park . Between 1978 and 1992, bison caused more injuries or deaths than bears did in Yellowstone (56 vs 12), rates of pickernick-basket theft are not reported.

Since the birth of the third white calf on the Heiders' farm, Native Americans have been making donations of tobacco and dream catchers at the Heiders' farm and have been holding drumming vigils to honour the auspicious arrival. Bunch of tree-huggers! Visit Heiders' farm shop for all your cigarette and dream catcher needs.

Animal of the Week September 11, 2006 -- Blessed are the cheese mites

2006-09-13T13:40:00.000+01:00

"Oh dear! Oh dear! I shall be too late!"

Sorry, have been working like a llama on coca for the past three days and just not had... ach, you don't want my excuses, you just want Tyrophagus casei (cheese mites).

Well you may not actually want them, they can cause contact dermatitis (affectionately referred to grocer's itch) and ruin your double Gloucester. These tiny arachnids reach no more than 0.7 mm long, and can be found all over your groceries, in damp flour, and even in honeycomb, but they have a particular affection for cheese. Several grocery mites live in a variety of environments, flour mites can be found (quite literally) all over the shop, and prune mites (I kid you not) are also partial to life in other dried fruits and jam. I want to live in jam, I really do...

Although they can cause food spoilage and a mild allergic reaction, cheese mites do have their uses. In Saxony-Anhalt (central Germany) there is an ancient tradition of making Spinnenkäse, also known as spider cheese, or more correctly Milbenkäse, mite cheese. Raw curd is salted and flavoured with caraway seeds (mmmm minty), rolled into balls, and put in a box full of mites. The mites burrow into the cheese, and their various waste leads to fermentation which imparts a piquant, bitter flavour. The cheese is eaten either early when yellow, later when reddish brown, or by the brave when black (completely coated in a layer of dust, made up of mites, their skin, and their faeces). Altenburger is another cheese made with mites (or possibly the same cheese, my German is not so good).

Cheese mites featured in at least two poems by Sir Arthur Conan Doyle, here is one, sadly not called The Adventure of The Dusty Cheese:
A Parable
The cheese-mites asked how the cheese got there, And warmly debated the matter;The Orthodox said that it came from the air, And the Heretics said from the platter.They argued it long and they argued it strong, And I hear they are arguing now;But of all the choice spirits who lived in the cheese, Not one of them thought of a cow.
I always feel guilty when I'm late with an animal, so next week's will also be late to give the cheese mites a fair shot. And next week's, animal will have an as yet undetermined tenure while I take a break to reorganise my life—more on that then. Must dash, the King and Queen of Hearts will be wondering where I've got to.

Animal of the Week September 04, 2006 -- RIP Steve Irwin

2006-09-04T12:56:00.000+01:00

RIP Steve Irwin,

I heard the news as the half-light of dawn crept around the the edges of my curtains, with sleep still gooing up the corners of my tired little eyes, I couldn't quite believe it, but it's true. Steve Irwin, all-round Australian, crocodile harasser, and conservationist has been killed by a stingray sting to the chest. Although I prefer a less intrusive tv presenter to show me animals, as a populariser of conservation issues and advocate for maligned reptiles, Irwin was hugely successful and popular.

As a mark of respect, this week's animal of the week is Dasyatis brevicaudata (smooth stingray, bull ray, short-tail stingray), reportedly the species that did for big Steve. There are about 70 species of stingray, some living in freshwater in Asia, Africa, and South America, but most living in marine environments. The smooth stingray is the largest marine species reaching 430 cm in length and weighing up to 350 kg.

All rays are, like sharks, cartilaginous fish; but unlike sharks, because their eyes are on the top of the body and the mouth on the bottom, they never see what they eat, rather they use smell and electro reception to locate prey beneath them. Most eat molluscs, crustaceans, and small fish. The spine is used in defence and the raising of the tail is an automatic reflex to a threat or attack, there is no intent to harm.

Stingrays have one or more razor-sharp spines on their tails, in large species the spines can reach over 180 mm in length. These barbs are coated with fierce toxins that cause substantial pain. Generally stingrays are not aggressive and avoid confrontation, it is very rare for people to be stung, usually this only happens if someone treads on a concealed fish, typically a resulting sting to the leg will be uncomfortable for a couple of days, but rarely fatal. In very rare cases, as in Irwin's, a sting to the heart or chest can puncture a vital organ or cause severe toxicity sufficient to kill.

The producer of the show he was filming at the time of the incident says that, if Steve were here, he would say, simply "Crocs rule!". A bit of a downbeat topic today. But he died doing what he was best known for and something he loved. So big respect to Steve and his family and friends.

Animal of the Week August 28, 2006 -- The most gruesome parasite?

2006-08-28T12:51:00.000+01:00

Ahhh, a Bank Holiday trip to the seaside. Delightful seafood served fresh from the ocean. Yum yum yum. "What's your favouorite fish?" I asked my friends as I ploughed through a selection of fried seafood, they'd say "Oh I don't really know". I'd say, "I really like hake, it's delicious, the Spanish have a way with it."

I also really like red snapper, as, it turns out, does this week's animal of the week Cymothoa exigua.

In perhaps the most disturbing act of parasitism I have ever heard of (maybe tied with that catfish), this isopod crustacean (an aquatic woodlouse) latches on to the tongue of a red snapper and taps into the blood supply. As the parasite grows, the fish's tongue wastes away. Eventually, the snapper's tongue withers completely, by this point the parasite has switched from living off the blood supply to nicking some of the food the fish catches. But don't feel too upset for the fish, it can carry on just fine because by now the fish is using C exigua as its tongue instead. Obviously it would be better for the fish if it didn't have to share its supper with the crustacean, but they can continue to grow, remain healthy, and sometimes even make it into fishmongers. Although this bizarre relationship is only known from the Gulf of California, last year, one unlucky customer in London bought a red snapper only to discover when he got it home that it had a marine woodlouse for a tongue. I'd just get your fishmonger to take off the head and never even think about it.

Animal of the Week August 21, 2006 -- The Androscoggin Beast

2006-08-21T14:37:00.000+01:00

Twas brillig, and the slithy toves
Did gyre and gimble in the wabe:
All mimsy were the borogoves
And the mome raths outgrabe

Headlights chase the darkness down a forest lined New England highway. No other cars on the road, only the short tunnel of light specked with drops of luminescent drizzle. Something shoots across the tarmac on the edge of the light, running so fast that the young couple in the car can barely make out that it's a raccoon. Wwwwwmmmmmmmmmffffff, Dffff
"Oh my god, what was that?" shrieked the young man in the passenger seat.
"Just a deer or something"
"Stop the car"
The young woman braked and pulled over to the side of the road and reversed back to where they had hit something else running out of the forest. Steam rises from the body, swirling in the livid glow of the taillights. The car stops and the couple get out. Cautiously they approach the lifeless heap of grey fur.
"Jeez man, that sure don't smell like any deer I've ever come across."
By morning, the small towns of Litchfield and Greene are buzzing with news, rumour, and exaggeration: "They hit it!", "They got the beast", "The car was totalled", "100 pounds with three inch fangs", "A bears hind leg in its jaws". The legendary beast of Androscoggin County—scourge of a handful of small Maine towns, savager of rottweilers, red-eyed hellmonster—was dead, killed by chance.
Over the next few days the stories became as tall as the poplars in the forest—a dingo, a hyena, part gerbil part wolf, part dog part bear, part gorilla part chicken. Few had actually been to look at the beast's body before it was picked clean by the turkey vultures and the bones dispersed by foxes. But people had seen it before—fleeting glimpses in their gardens, a head shoved through a garden hedge after a terrified cat, quickly withdrawn on sight of a human being. Its short muzzle, demonic eyes, and drool-smattered fangs were part of the collective consciousness of Androscoggin.
As news spread, the interest of local cryptozoologist (a researcher into mythical or legendary animals) Loren Coleman (in the movie, played by Jeff Goldblum—natch) was piqued. A few photographs were taken, but no other evidence of the body remains. Trying to gather as much information about the victim of the road accident, Coleman ascertained that the creature was about 40 lb (hardly a monster), charcoal-grey in colour, and in possession of short triangular ears, a bushy tail, and a short muzzle. The zany scientist recalled a previous case of a similar beast shot by a hunter elsewhere in New England, investigators had hoped to prove the existence of werewolves or at least a new species of predatory mammal, but DNA analysis had shown the mystery creature to be a wolf–dog hybrid. Bolstered by Coleman’s backing the authorities sent word out that even he, a professional chaser of non-existent chimeras, believed the animal to be nothing more than a feral mongrel, or, at most, a hybrid of a dog and coyote. Oh… what an anticlimax! Thus ends the near fact.

“And, has thou slain the Jabberwock?
Come to my arms, my beamish boy!
O frabjous day! Callooh! Callay!”
He chortled in his joy.

Of course, in the movie version, that’s just the beginning, the townspeople return to their quiet everyday lives, rather embarrassed about having got so worked up about a stray dog. Here we cut to some government bunker where a crazed scientist (Tommy Lee Jones) splices together genes from bears, wolves, chupacabras, and emus to create a mega-army of beasts with which to wage war on the just people of New England. Nothing stands between him and world domination but the determination of a seemingly mad old woman (Lilly Tomlin) who knows what is really going on, and who, with the help of eye-candy grand-daughter and her love interest (Lindsay Lohan and Jesse Metcalf), manages to reawaken the scepticism of Jeff Goldblum by supplying him with a curious sample of fur from the beast that killed her husband. And what do the babies of the monsters that Tommy is creating look like, you guessed it, the critter killed in the opening scene—it was just a pup.

Animal of the Week August 14, 2006 -- Kimberella

2006-08-14T15:25:00.000+01:00

As I got distracted from my aim to balance out the phyla last week by the woolly-hairy madness of the geep, this week's animal is as contrary to my mammalian favouritism as I can get. Introducing.... Kimberella!

Although it sounds like the lead character in an animated modernisation of the Cinderella fairytale, it's actually one of the earliest animals known in all the whole wide world, ever ever ever. Kimberella is a Vendobiont, one of the lifeforms that lived before the groups of modern animals lived (not be confused with a Vengaboy, one of the lifeforms that proves evolution is a random process not overseen by any guiding force—or at least not an omnicognisant one). The vendobionts lived during the Ediacaran age (635–542 million years ago). Kimberella is in no way the oldest known vendobiont, but for many of the others, whether they are plants or animals, algae, fungi, or something else entirely is a matter of debate.

Before 635 million years ago, the world was just a great big snowball. In springtime 634 million years ago, the ice began to thaw and over the next 80 million years diverse forms of soft-bodied life appeared. Whether any of the forms that evolved in this period have descendants alive today is unclear. Some of the fossils bear similarities to jellyfish and starfish, but their associations remain doubtful. Kimberella is itself supposed by some to be mollusc, a limpet without a shell perhaps. It certainly seemed to have bilateral symmetry, and mollusc like trails thought to have been left by Kimberella have been found in some rocks from this period.

At the end of the Ediacaran period, the vendobionts vanished...At the end of 2002, the Vengaboys seemed to have vanished too. However, I have just learned (my research for AOTW covers all bases) that there was a reunion gig at the Astoria in London on July 15 this year! Coincidence that they should reform on my birthday? I bloody-well hope so.

So there you have it, perhaps the most ancient animal that will ever be animal of the week!

Ta

PS, if anyone knows any cheapish accomodation with good access (bus, bike, walk, tube) to South Kensington in London that will be available from mid-September, give me a shout. I am easy going and quite presentable, independent, considerate, a generous and able cook, and versed in the changing of lightbulbs (bayonet and screw fitting).

PPS, apologies for overuse of pop culture references. Next week, I promise, no mention of camp pop, television I have watched, or eighties US teen comedy series.

Animal of the Week August 07, 2006 -- Geep

2006-08-07T11:00:00.000+01:00

So, I recently finished uploading all the available Animal of the Weeks onto the blog (http://animal-of-the-week.blogspot.com/), and do you know what I noticed? Most AOTWs have been vertebrates (fish, birds, mammals, and the like); among the vertebrates, mammals are vastly overrepresented. Indeed, last week's animal was the first time that a genus has been repeated, and what was it? Yeah, a primate (http://animal-of-the-week.blogspot.com/2006_07_01_animal-of-the-week_archive.html, http://animal-of-the-week.blogspot.com/2004_12_01_animal-of-the-week_archive.html). Classism, maybe... and I had never really thought of myself as being prejudiced.

So today I was going to start at the bottom, and over the next few weeks intersperse some of the more basal animals groups with the regular role-call of bird muderousness, new monkeys, and seafood recipes. So, there I was, reading about sponges in preparation—the least animal-like of all the animals, sponges are a sister group to all other animals. Sponges are simple animals with no distinct tissues, although they do have functionally differentiated cells. I have known for many years that if you put a sponge in a blender, surviving cells will reform a complete and living sponge. But here is where I got distracted by the wikipedia entry: "If multiple sponges are blended together, each species will recombine independently (contrast animal chimera such as the geep)". Now, a chimera is an animal comprising cells of two different species. And, knowing scientists as I think I do, a chimera called a "geep" can only be one thing. Yes, this week's Animal of the Week.

Apparently, if you put a sheep and a goat in a blender and then leave to stand, the cells don't separate out and you end up with a geep. You clearly have to do this at a very early embryonic stage, leave it too late and you end up with so much doner meat. But if you blend embryonic cells of the two animals and then implant the resulting mash into a host womb (preferably a sheep or a goat) a fully functioning, four-footed beast will grow. Some parts of the body develop from sheep cells and others from goat cells. In the picture, you see the legs are woolly (sheep) and the back hairy (goat). Unlike a hybrid animal (such as the wholphin AOTW 25/04/05) which has two parents from two species, a geep has four parents from two species. Put that in your pipe and smoke it Nicole Bradford!

Animal of the Week July 31, 2006 -- Make it stop!

2006-07-31T14:35:00.000+01:00

**WARNING: CONTAINS STRONG ASTERISKS**
Right, look, I know Sundays are traditionally a day of family outings, long lunches, and quiet down time, but there are vast swathes of people who, in the late afternoon, want to vegetate in front of the television. In a world in which every tinpot organisation has a tv channel, I guess the following statement is going to make me look like a bumpkin extolling the virtues of scythes over those of combine harvesters, but I believe that five channels should be enough, and only have the old terrestrial package. So, yesterday afternoon, with the effects of the previous night's party kicking in, I slumped into an armchair, switched the television on, and picked up the tv guide. My viewing options were as follows:

BBC1: As Time Goes By -- Geoffrey Palmer and Judi Dench besmirch their careers with tawdry snail-paced "comedy"; a repeat.
BBC2: Some Mothers Do 'Ave 'Em -- Perenially repeated "classic" sitcom, many hold this in great affection so I'm not going to slag it off too much, but every episode must have been shown at least 100 times in the past 20 years, and in all fairness the only three jokes in any episode are Frank Spencer's silly voice, his ill-fitting clothes, and him falling off a roof.
ITV: Call Me A Cabbie -- in which celebrities who have unfortunately been brought back from the jungle (the two greatest problems with I'm a Celebrity Get Me Out of Here are that it's televised and that any of the participants are ever allowed "out of here" [although I'd watch "Celebrity Lost", in which there is no hope of rescue and every chance of mauling by a polar bear]) face the challenges of learning The Knowledge and picking up mockerny accents under the tutelage of a cabbie mentor. The celebrities, you ask: Janet "Ramblin'" Street-Porter, Carol "Iron Mumsy" Thatcher, and Jeff "ex-Mr Jade Goodie" Brazier. Words cannot describe my feelings about this concept (they can actually, but the image I have concocted cannot be broadcast for fear of offending people, those of strong constitutions might like to ask me about this). Call Me A Cabbie is surely the lowest TV ever created...Oh wait
Channel 4: Britain's Top Dog -- Each episode, four untrained dogs and owners from a different region (this week, the southwest) are selected by a panel of three judges then given intensive training before they compete by perfoming agility exercises, scent-trials, and doggie dancing. I have no idea what the point in this show is, perhaps to showcase the complete lack of appropriate care for people with mental incapacities in the regions featured. The normalised insanity of the westcountry truck driver who takes his shelti waterskiing and motorbike riding and the woman with 16 dogs were completely overshadowed by the three-time divorcee whose jack russel had become her fourth husband (when we first see them in their everyday life, she is receiving a massage, the dog is beneath the massage table licking her mouth and she DOESN'T TELL IT TO GET OUT OF THE MASSAGE PARLOUR, BUT SHE KISSES ITS FILTHY DOG TONGUE!!!). Liza Tarbuck, presumably taking huge amounts of ritalin to remain focused on the hyperbanal pile of crap, guides us through the show, and although she never really manages to sound excited she does a fantastic job of not slitting her wrists live on air as a poodle stands still for a full minute completely failing to give a damn about its owner's stolen wallet that has been secreted in the turn up of a mock-theif's trouser leg in the scent trial. The absolute nadir was watching the trucker getting so excited about doggie dancing that he put in hours of intensive extra training and at one point tried to get the dog to jump through his legs as he did a headstand. This was, it turns out, the third of four regional heats. It's f*ing Dog Idol, and it's wrong, wrong, wrong... please read the middle column of this webpage (http://www.channel4.com/about4/overview.html) then consider the show I have just described. F*ed up.
Channel 5 -- Robocop: The Future of Law Enforcement (fourth part of awful film franchise -- I'd have considered watching this but had missed the first half hour, so probably wouldn't be able to work out what was going on).

But salvation was at hand, in just a few minutes, when Frank Spencer had received an amusingly placed bandage and supremely embarassed himself in front of his mother in law for the fiftieth time (I didn't watch it, but I know these things happened), The Natural World would start. Nature documentaries, that's what Sunday should be about! I decided that whatever it was that was the subject this show would be AOTW. Turns out though, scheduling and programme making had been taken over by three year olds and that The Natural World was one of those god awful storybook accounts called The Monkey Prince in which Kristin Scott-Thomas, providing the narrative voice of a baby female monkey born into a troop of monkeys in India, told the tale of a fellow baby monkey, born to a high ranking female, but cast out after his mother died, but who then rose to the highest rank after surviving many precarious adventures in his life. Suffice to say it was f*ing sh*. First off, they didn't even tell you what type of bloody monkey it was. Why we were supposed to believe this was not just a re-edited footage from six different old documentaries to provide a blatant rip-off of the Lion King, I do not know. White-Ear, Long-Tooth, and Nine-Fingers and the rest were probably all real monkey's, but why, after naming the troop after physical attributes, The Monkey Prince, the longsuffering but triumphant focus, was called Bobo, and not No-Mum or something, I cannot fathom.

So, this week's animal of the week is Macaca mulatta (rhesus macaque), an animal so interesting there are at least three informative documentaries that could be made about it without people becoming bored. Named after a King of Thrace, these animals have given their name to a blood factor—if you're blood type is A negative, the negative refers to a lack of the rhesus factor—that was discovered in them. Widely used in research these are the archetypal primate research model and have facilitated numerous medical and scientific breakthroughs and the focus of many campaigns against animal experimentation. Rhesus macaques live across south Asia, from Pakistan to Thailand; they are highly adaptable, living in hot arid regions, forests, and even mountainous areas where the temperature might regularly fall well-below freezing. In areas where breeding is seasonal, the male's already large testes swell even more during the mating season. Both males and females have strict dominance hierarchies: one male fathers most of the offspring in a troop until he is deposed by a younger, stronger male; the highest ranking female will have best access to food and protection from the males. In China and Thailand, competition with and exploitation by people have forced them onto the margins of existence, in India they have adapted to life with humans, and in some places troops live in metropolitan areas. Not one of these facts would you have gleaned from watching The Natural World yesterday. Sentimental tosh. Grrrrr!

I turned back to the dogs for a bit; then gave up and went to check that the gas was still working in the oven and that our toaster flex stretches to the bath in case such a situation ever arises again.

I thinkyou thanks

Animal of the Week July 24, 2006 -- Ginormous Jellyfish of Japan

2006-07-24T13:35:00.000+01:00

Hola!

A couple of months ago, the humble mayfly was AOTW, after a couple of days of mass hatchings and dyings the insects have been known to clogg up cooling-water intake pipes of nuclear power plants. Well, now other invertebrates are getting in on the anti-nuclear act, Chubu Electric had to reduce production at the Hamaoka power plant to 60% when not enough cooling seawater could be sucked up due to the pipes being blocked by this week's animal Stomolophus nomurai (Nomura's jellyfish, echizen kurage). Whatever next, CND centipedes?

These giant jellyfish have been appearing in unusually large numbers around the west coast of Japan for the past few years. As densities have exceeded 100 times the normal levels, fishermen in the Sea of Japan trying to catch anchovies, shrimp, and the like have been thwarted by the jellyfish, the weight of which would break their nets. If they did manage to haul a net aboard intact it would be filled with either a lump of jellyfish or fish so slimed up and poisoned that they could not be sold.

The danger posed by the jellyfish is probably quite minor—nuclear power companies are used to having to clear typhoon debris, swarms of shrimp, or the occasional dolphin from their cooling pipes. Although the 2 m wide, 200 kg jellies can sting, their poison is only very rarely fatal to human beings.

However, what should happen if the jellyfish make it to the nuclear source?! As a child, I remember seeing in the news a story about a giant radioactive moth attacking Japan, they had to get this dinosaur type thing to sort that out.

Should you be stung by a jellyfish this anchovy season, remember that weeing on the sting as recommended by the school of received wisdom is not a good idea, it'll cause more poison to be released. Ideally apply a weak solution of vinegar, if no vinegar is available, use bicarbonate of soda, if this is unavailable, use meat tenderiser (apply for no longer than 10 minutes). If you are not in a kitchen when stung, wash with sea water (that you have first carefully inspected for jellyfish).

Revisit some of the old Animals of the Week at http://animal-of-the-week.blogspot.com/ I don't like blogs, but what can you do?

Ta

Ps, if anyone knows any cheap accomodation with good access to South Kensington in London that will be available from the September 22-ish, give me a shout.

Animal of the Week July 10, 2006 -- World Cup Nations 5 Italy are the Champions

2006-07-10T14:47:00.000+01:00

Hey Kids,

I so nearly chose some form of headbutting goat as French AOTW last week, gutted that I didn't, pah! I loved Zidane's caprine charge, much more graceful than the jolting Glasgow kiss with which we are more familiar in modern times. Not that I watched the match you understand... oh no.

Well, that's football done for another 4 years. And as the World Cup wings its way to Italy, this week's Animal is in memory of another item that will hopefully be returning to the boot of Europe, JJ1 (Bruno the bear). The 2-year-old member of the subspecies Ursos arctos arctos (European brown bear) was born in Italy in the Adamello-Brenta natural park of the Trentino, South Tyrol, region of northern Italy, but had a somewhat less successful trip to Germany than the Italian football team.

The return of a bear to Germany after a 170 year absence of the species was initially heralded as a landmark event in the repopulation of Europe by bruins. The bear's stereotypical behaviour delighted me, the first report I read had him raiding a beehive for the honey. I was awaiting the news that he had been witnessed pilfering pickernick baskets. Although he did frustrate the local rangers for a while, he fatally moved onto a diet of sheep, rabbits, chickens, goats, and a for dessert a guinea pig, and from then on started to rankle German authorities. Brown bears can kill a cow with a single blow of a paw, outrun a horse, and swim faster than an Olympic swimmer. Farmers were upset by loss of stock, and people worried that Bruno's apparent lack of fear of humans could pose a threat to people as he came into close proximity with them. Attempts to capture him alive so that he could be relocated failed, Bruno evaded capture for several weeks. Finally the authorities declared open season on the ursine marauder and he was shot at the end of June. At the Italy vs Germany semifinal, fans waved banners calling for revenge for Bruno. Italy have now asked for JJ1's body to be sent back, although the most recent reports said that the plan was to stuff the 2 m animal and install it in a museum in Bavaria.

Over the past 10 years, Italy has had some success in reintroducing this majestic predator to some regions and, along with Slovenia and Austria, is helping to re-establish populations of bears throughout the south-central Alps -- not to be confused with the "bears" of South Central, Vauxhall.

Not really a happy story for Bruno, but perhaps this episode will encourage people in Germany and elsewhere to consider how they might one day live side by side with bears as they recolonise Europe. The species has begun to make a comeback in France and Switzerland as well. Whatever, the North Sea and English channel should keep me safe from the advances of the bears...

Animal of the Week July 03, 2006 -- World Cup Nations 4 (France)

2006-07-03T09:06:00.000+01:00

I guess many of you are reeling from the results over the weekend (although not the Sri Lankan, Portuguese, German, and Italian readers—do I have any French recipients?). I was so mortified I had to have an extra day to gather my thoughts. Anyhoo, now I can no longer preempt England's opponents, how do I choose the featured nation? By adopting England's nemesis Portugal, that's how.

So, on Wednesday the land of sardines will face the land of…Threskiornis solitarius (the Réunion sacred ibis)! I am well bored of Europe…but Réunion is département d’outre mer of France in the Indian Ocean. So while its residents tender Euros, the fauna of Réunion is somewhat different to that of Portugal and Sweden (unlike France's hybrid of the two). The first Europeans to land on Réunion were, rather serendipitously, Portuguese sailors in the early 1500s; however, by the mid 1600s the French had taken control, and the island, east of Madagascar and about 200 km south of Mauritius, was officially a part of France, as it is to this day.

The first people to name the large, nearly flightless, bird of Réunion called it a solitaire, a name also given to a close relative of the dodo found on the island of Rodrigues (in the Mascarene islands, a part of Mauritius). This name, descriptive of its solitary habits rather than its similarity to the Rodrigues solitaire, led people to classify the Réunion sacred ibis, then only known from historical reports, as an albino dodo or Réunion solitaire. A few year ago, however, bones discovered on the island clearly showed that the bird was no more a dodo than I am really interested in the football. Instead, the bird was most similar to the sacred ibis of Madagascar, mainland Africa, and the aviary along the Regents Canal by Primrose Hill, London.

Ibises are wading birds of marsh and shoreline. And for a while the Réunion sacred ibis happily roamed the island preying on ostensibly Portuguese cockles and winkles, but the settlement of the island by the French was like a red-card from an Argentine referee for the sacred ibis. By the late 1600s the birds were very scarce, the last sighting was in 1705, by which time the species was as doomed as a failed England coach.

Join me next week for a final celebration of the world´s most ............ sporting event.

Animal of the Week June 26, 2006 -- World Cup Nations 3 (Portugal)

2006-06-26T09:14:00.000+01:00

So, Portugal eh, apparently football is the national sport of Portugal, just as, after kabaddi, it is in England. But what about an animal to symbolise Portugal, welcome this week’s animal of the week Sardina pilchardus (sardine, sardinha [Portuguese]). Given England's love for these little beasts served from an iconic rectangular tin, you might be excused for thinking that they could be this nation's animal too, but herein lies the fundamental difference between these two outposts of western Europe, the Portuguese love them fresh.

In Portugal, 90% of the sardines are consumed not from a can, but straight from the sea. The way to eat your sardines is apparently simply grilled, preferably over charcoal served with boiled potatoes and a salad of grilled green peppers, basil, and olive oil, sounds delicious; I’m going to Hatt’s fishmonger first chance I get.

This celebration of the sardine in Portugal would have been more appropriate a couple of weeks ago, for June 13 was St Anthony’s feast day, when people take to the streets of Lisbon to feast on sardines cooked over open grills on the street. Sardine season lasts from April to November when the plumpest fish can be caught in abundance in the eastern Atlantic by the traditional Portuguese fisheries.

What is a sardine? Well, you may gather from the Latin name that Sardina pilchardus are actually pilchards, and the contents of your can of sardines and your can of pilchards are the same species, sardines are simply younguns. But what is a pilchard? In fact there are at least six species of fish called pilchard and at least 12 called just sardine. So it’s all rather complicated—but hey, they all look pretty much the same when barbecued or squished three to a can with tomato sauce.

As a nod to the wonderful country of Ecuador, here is a song about llamas http://www.albinoblacksheep.com/flash/llama.php. Sorry if you have seen it before. I've watched it too many times and am numb to it now but if you've not seen it, well, you might be amused...or scared.

RIP Bruno

Animal of the Week June 19, 2006 -- World Cup Nations 2 (Sweden)

2006-06-19T08:42:00.000+01:00

Hello all,

This week's animal is the unofficial animal of Sweden, Alces alces (elk, Älg [Swedish]). In North America these animals are known as moose (from the native American Algonquian word 'moos' meaning 'leaf eater'), but, as we are on Sweden this week for our World Cup nations themed animal of the week, it's elk all the way. With a population of 250 000 elk, Sweden has the highest density of and the best chance of spotting this magnificent creature anywhere in all the world.

Elk are the largest member of the deer family alive today and, in many places where they occur (as in Sweden), the largest terrestrial animal. They are also quite dangerous, males during the rut and females when with a calf have been know to attack people. By far the greatest danger to human beings posed by elk is that of road accidents. With a high centre of gravity, upon impact with a car the spindly legs snap and 500 kg of venison and antler shoot through the windshield with disastrous consequences for elk and motorists. The Älgtest (Elk-test) was developed to test rapid cornering of cars to simulate navigation around an elk in the road at high speeds. Saab's elk test includes simulated collision with elk to test their reinforced windshield.

Across their range, road signs warn of this risk; attached is the Swedish interpretation. Like a nation of drunken students, German tourists find these warning signs hilarious and make trips to Sweden to gather them. The Swedes have made it a criminal offense to take the roadsigns and instead have produced a range of tourist tat bearing the roadsign image. Postage stamps in the form of the warning sign were even developed to appeal to the German tourists sending postcards home. The elk warning sign is Sweden's equivalent of our royal family.

Stepping away from Sweden, in Fairbanks Alaska, it is illegal to give a moose alcohol. One wonders why they had to instigate this law at all but also why here and nowhere else?

If you should meet an elk, here are some simple survival tips.

1. If you meet an elk on a path, turn around and walk away, this is what elk do when recognising another elk's superiority.
2. Never get between a cow and her calf.
3. Try to get behind a tree if an elk charges. You can run around the tree better than it can.
4. Remember, if you see its ears laid back and/or the hair on its "hump" stand up, it's angry or afraid and may charge.
5. Elk can kick with their front legs as well as their back.
6. If there is an elk in the road in front of you, be patient, wait for it to move.

It occured to me that I should be preempting England matches rather than covering the nations retrospectively. So, unfortunately, Trinidad and Tobago gets skipped. But look out for a T&T special when the world cup is over.

Remember to play safe and enjoy/endure the World Cup responsibly and with respect for your fellow human beings.

Animal of the Week June 12, 2006 -- World Cup Nations I (Paraguay)

2006-06-12T12:25:00.000+01:00

Good Monday one and all,

Those of you who know me will know how excited I am about the World Cup! Not one bit, which explains why I am trailing a week behind with my nations-themed animals. This week's animal Chlamyphorus retusus (pichiciego, fairy armadillo) is an inhabitant of the Gran Chaco, an area of dry scrubland with rich plant and animal diversity in the homeland of this weekend's losers against England, Paraguay.

There are two species of fairy armadillo in South America, surprisingly the pichiego is the less gay of the two, the other being the smaller "pink fairy armadillo" (Chlamyphorus truncatus). The fairy armadillos are less heavily armoured than some of their cousins, being noted for their downy white hair on their sides and bellies. Both species are able diggers. Thankfully, after last week's epic, not a great deal is known about these animals except that they sometimes make a noise like the crying of a human baby. They survive largely on a diet of ants and grubs, although one individual kept in captivity survived solely on a diet of grapefruit and rice. How long it survived on this diet is not reported.

And wow, look at the size of these guys' hands, maybe if Paraguay had had one of these as goal defender on Saturday afternoon the British wouldn't have been able to score a bullseye in the first chukka. Come on the lads!

Animal of the Week June 5, 2006 -- Islington to Camden on a sunny morning or Gulls kill pigeons by drowning them

2006-06-05T10:13:00.000+01:00

If you need to get from Islington to Camden on a sunny morning you could do worse than take a stroll along the Regent's Canal. From Angel tube, cross the large junction to Liverpool Road. Head up Liverpool Road a short way and turn left by the far side of Sainsbury's onto Tolpuddle Street, walk the length of this thoroughfare, at the end, turn right and sharp left onto Maygood. Walk through the Maygood Estate (a perfectly tasteful Islingtonian estate, in the afternoon the teenagers play football in the basketball courts [how obtuse?] and shout obscenities about a transvestite on the new series of Big Brother "No but mate, we all fancied her till we found out", "Yeah, I f* did" -- which is honest of them). Cross Muriel Street and head down the ramp to the canal. You are now at the west end of the Islington Tunnel, you can only head away from the rising sun. Head west.

The air is thick with the scents and pollen of mayflowers and cow parsley; hayfever sufferers would be wise to take a Claritin or somesuch before the journey. Robins and wrens chatter in the bushes. Blackbirds root noisily through the leaf litter. As you walk along the canal look out for the various families of ducks, moorhens, and coots that swarm busily, chasing midges and other insects along the mirrored surface of the water, shattering the reflections of cotton-wool clouds in their wake. Lone fishermen's eyes droop contentedly as their rods dip to the water, floats bobbing gently, unbothered by fish. Cyclists' bells chime as they clatter under the bridges: Caledonian Road, York Way (where I doff my cap to the Macmillan building). At Camley Street nature garden look out for the terrapin that sometimes floats in the surface of the water or basks on a floating beam alongside the ducklings.

The canal now finds the north in its bearings. At St Pancras Lock a pair of coots brood a late clutch of eggs in the weir. Flotsam and jetsam lap against the lock gates, floating rafts break through each time a boat passes. Where on the earlier, western, stretch cow parsley and alexanders were the most prominent flowers, the verges on this northwestern segments are overshadowed by nodding spotty stems of hemlock, some reaching eight or nine feet tall. Pass the man doing tai chi, well it looks like tai chi, but I think he is a mental making it up, though I am no expert. You'll pass The Constitution (affectionately labelled The Con in the graffiti on the canalside wall), which I am reliably informed is a good pub although I have yet to sample it's delights (including a free barbecue on a Sunday night and a spacious waterside garden). Go under St Pancras bridge, there is another floating beam, in the winter a pair of red crested poachards (the only duck of the region with a bright red bill) could often be seen perched there. The other day, this beam looked to be crowded with a family of mallards, on closer inspection they turned out to be a covey of pigeons. As I got closer, the pigeons were rattled and tried to take to the air, but before they could clear the area this week's animal of the week swooped in, a Larus argentatus (herring gull), its wings, feet, neck and head all outstretched to give maximum coverage. As the gull bowled into the panicked pigeons, one was knocked into the water. The pigeon managed to haul itself onto the beam again, but now waterlogged it could not take to the air. The gull went up to it and knocked it into the water again. The pigeon flapped pitiful trying to distance itself from it's marauder. But the gull swooped down, ducking the hapless bird once, twice, three times. Eventually, warn out, waterlogged, and beaten, the pigeon throbbed limply in the middle of the canal, it's time was up and soon the gull would eat.

The beam generally isn't that interesting, so you'll probably keep walking, under Royal College street, then the very narrow Camden Road bridge, pedestrians and cyclists generally whoop or whistle as they enter to avoid the inevitable crash (I typically whistle a southern gospel song as I pass through the UV lit tunnel -- they use UV I guess to stop the junkies finding their veins). Here the quality of walk deteriorates, young punks drinking cider at eight in the morning sit on the lock outside the TVam/MTV building, where herring gulls perch atop masonry eggs, looking for all the world as though they are trying to hatch an outsized chick. Piles of vomit, discarded beer cans, half eaten kebabs (from Zula Vegetarian and Chicken which once was Tasty Corner), the detritus left by Camden's crapulous rogues.

Next week: Camden to Islington in the afternoon, 214 or 274?

Animal of the Week May 29, 2006 -- Potter dragon dinosaur simon and garfunkel

2006-05-29T13:40:00.000+01:00

Oh my god, this is amazing! A flat-headed pachycephalosaur from the late cretaceous of North America. They've only been found in Asia before. And that's one in the eye for all the people who think that the flat headed type preceded the dome heads! What...?! You're not interested in that? Are you crazy?! Oh, OK then, we'll appropriate a name from some wildly popular cultural phenomenon... cool, lets say it looks like a dragon from the Harry Potter series and name it Dracorex hogwartsia. Now you're interested right?

I'm sure you're all reading Proust, Cervantes, and selected essays by Hazlitt rather than kids' books (unless you're a kid, although nephew, Thomas, is most likely reading some weighty tome about dinosaurs), so I'll explain that Hogwarts is the school of wizardry at which Harry Potter is annoyingly successful at everything, is inexplicably excused all manner of misdemeanours, and despite being a despicable sycophant remains popular with staff and peers -- so I am told.

This newly discovered dinosaur lived 66 million years ago, the twilight years of the dinosaurs, in South Dakota, the twighlight state of the USA. Its thick skull and collection of bumps, knobs, and spikes suggest that like other pachycephalosaurs D hogwartsia fought by head-butting. The ornamentation of their heads led to comparisons to a dragon described in one of Rowling's books and hence the name given by palaeontologist Robert Bakker.

Bakker has form so to speak, other dinosaurs he has named include Attenborosaurus (after David), Bambiraptor (after Disney's deer), and Drinker nisti (after the National Institutes of Standards and Technology -- part of the US Dept of Commerce). Still, Bakker is by no means the worst offender for such tomfoolery, Leigh Van Valen spent much of the 70s naming extinct mammals of North America after obscure characters and objects from The Lord of the Rings. My present favourite examples of naming species after things are two trilobites (extinct sea creatures) in the genus Avalanchurus with the species names simoni and garfunkeli. Should I ever have a child I will call it Garfunkeli.

Animal of the Week May 22, 2006 -- Marriage special, the most metaphorical animal

2006-05-22T13:49:00.000+01:00

Marriage special
In honour of the impending nuptials of my sister and my soon to be brother-in-tax break *ducks to avoid clips round the ear*, this week's animal is one of the classic examples of monogamy, an albatross, Diomedea epomophora (royal albatross) to be specific.

Like other albatrosses, royals pair for life. Within the first 10 years of their lives they'll arrive at a breeding ground, a single boy albatross and a single girl albatross will furtively glance at each other, he'll sidle up to her or she to he in these enlightened times, they'll do a courtship dance: head nodding, pointing their bills to the sky, braying, stretching out their wings and strutting around, sometimes flying in tandem, occasionally exchanging gifts of fish, then they will be married—S&D, is it too late to change the ceremony?

They'll immediately leave the breeding island and feed for a few weeks, building up their reserves on a piscivorous honeymoon. On returning to the island the female lays an enormous egg and will immediately fly out to sea to replenish the energy put into the egg. The male will incubate the egg until the female returns to take over the duties. The adults exchange egg and chick duties for the next year or so. Eventually, when the chick is old enough, they'll desert it, returning to the open ocean. The chick eventually fledges when hunger drives it to flight.

Every two years the pair will return to the same nest site, consolidate their bond with a replica of their marriage dance and repeat. These birds might live for over sixty years, so remain faithful to their partners for upwards of fifty. That is as long as they don't get snagged by a longline fishing vessel.

So, while not a model to replicate in your marriage (the months at sea may be difficult to manage), this one's for you S&D, wishing you the best for Saturday and beyond (what a present, eh? No-one else has got you this *gleefully puts away credit card and logs out of the wedding list*).

Animal of the Week May 15, 2006 -- Brown rabbit

2006-05-15T13:52:00.000+01:00

Oh wow... what a weekend I had! I went to this crazy music festival on the south coast of England at a Pontin’s holiday camp. It was like Hi-Di-Hi but with Ruth Maddock, Paul Shane, Sue Pollard and the rest replaced by avant-garde folk and rock musicians... And it was wow so much fun, the music was great and the good-times rolled well into the evenings.

One evening I was sat up looking at the stars. And you know how it is when you look at the stars and you stare at the nearest and the brightest and then when you've focused on them you, like, see another layer behind them, and then you focus on those, and behind them, there are even more stars even further away and even smaller. But when you've been staring for a couple of hours it seems that the once inky-black night sky is just a carpet of white starlight travelling millions of billions of trillions of miles into your eyes. And I felt really small, like so small that I may as well not even have existed. But my hands felt so big, like they were reaching off into the universe, my interplanetary pinky poking Pluto and the thumb on the same hand shooting out through the Milky Way. With my fingertips I could feel the ripples of the big bang.

I was looking at the stars and lying on a sand dune and suddenly, I saw The Oryctolagus cuniculus (The Rabbit), staring at the stars too. I say The Oryctolagus cuniculus, because this was the first rabbit brought here by the Romans (hence the Latin name). She is about 2000 years old and the origin of all the bunnies in the UK, a rabbit god. And she turned to me and said. "Let me tell you a story", and I was like, "OK". And she said "Once, I was here sat watching one of my children eating grass minding its own business, but behind a tree there was a cat stalking the rabbit, the rabbit was oblivious to the cat's presence, and the cat was biding it's time, I could see the muscle tension in the cat's hind legs coiling in preparation for the pounce. But, unknown to the cat, behind another tree there was a badger, hungry and old, it had seen the cat and thought it might try its luck. But the badger was oblivious to the lynx, which still lived here then, behind the tree, eyeing up old brock. And the tufty ears was not conscious of the wolf, and the wolf unaware of the bear, and the bear had not noticed the angry old cow bison wanting to exact revenge for too many lost calves. Just as the kitty was about to pounce, badger dived upon the cat, the lynx leapt on the badger, the wolf jumped the lynx, the bear grabbed the wolf, and the bison trampled the bear. Ancient, and old, and finally at peace the bison lay down and died. And the only animal left was the rabbit, which grew old and had many kittens who would come and gorge themselves on the grass that grew rich where the all the bodies had decayed."

I was like, "Wow, that's an amazing story", and The Rabbit was like,"I know". And then I asked The Rabbit why she spoke with a Mexican accent. But she just formed a lagomorphic pyramid with her rabbit kin and they skipped away, The Rabbit on top juggling tiny moons.

How was your weekend?My summary: Nu-folk musicians touched=4. Favourite apple=Cox.

Animal of the Week May 8, 2006 -- Mayflies

2006-05-08T13:58:00.000+01:00

"What a difference a day makes, 24 little hours..." Dinah Washington new what she was singing about, she was singing about Ephemeroptera (mayflies). I know I normally do a single species and not a whole order of animals, but really, as if I am going to want to cover mayflies in AOTW again...*

There are over 2000 species of mayflies, and this group is one of the most ancient of insect orders. All mayflies are characterised by a short adult life lasting, in most cases, no more than a day; although they have a larval stage or nymph that lasts from a few weeks to several years. The nymphs live in fresh water rivers or streams, feedings and preparing for a frenetic adulthood. Commonly huge swarms explode from rivers over a very short period, at this time fish, birds, and, in some parts of the world, humans gorge themselves on the glut of crunchy goodness. In temperate Europe and North America most of the hatches happen between April and July. So any day now folks. Nuclear reactor workers do well to prepare for the hatchings as the masses of dead mayflies have been known to block the intake of water for cooling.

People thinking of eating mayflies should remain mindful of the story of Deichtine. In Irish myth, the god Lugh, in the form of a mayfly, landed in Deichtine's drink and after being swallowed made her pregnant with Setanta (who later adopted the name Cuchulainn and became one of the great heroes of Ulster). Not sure if that can really happen, but it's probably best to cover your mouth if beholding the spectacle of a mayfly hatch.

The mayfly in this picture is Ephemera danica, the UK's biggest mayfly and a popular model for fishermen's flies.
What a difference a day made
Twenty-four little hours
Brought the sun and the mayflies
Where there used to be rain
My yesterday was blue, dear
Today I'm part of you, dear
My lonely nights are through, dear
Since you said you were mine
What a difference a day makes
There's a rainbow before me
Skies above can't be full of mayflies
Since that moment of bliss, that thrilling kiss
It's heaven when you find mayflies on your menu
What a difference a day made
And the difference is mayflies

*Oh yeah, next May

Animal of the Week May 1, 2006 -- Probably the rarest mammal in the world

2006-05-01T14:04:00.000+01:00

Happy Summer (Or winter for those in the antipodes, if you're non-seasonal, lucky you)

Some animals make me doubt my faith in evolution and wonder whether some prankster has been guiding the development of at least a few species. For example, pandas, on a branch of the family tree sprouted somewhere bears and raccoons (two generally adaptable groups of animals), the ancestors of this large should-be carnivore decided to ditch the meat eating and become veggie. Not only did they choose to foresake highly nutritious viands, but they decided to subsist solely on a diet of a highly un-nutritious grass of which they would eat only selected shoots that appear every few years.

Similarly, river dolphins... in the oceans of the world, dolphin species travel in enormous numbers, sometimes gathering in groups of thousands, frolicking abundantly in vast, clear, fish-packed waters. But on several occasions in Asia and South America a couple of dolphins have looked at the murky silt-choked effluent of major rivers and thought "I know, I'll try my luck". And so, this week's animal of the week, the possibly extinct Lipotes vexillifer (Baiji, Yangtze river dolphin), probably the world's rarest mammal.

Like other river dolphins, Baijis have very poor vision, they use echolocation and their long slightly upturned beak to search for fish in riverbed silt. Never the most abundant animal, commercial and illegal fishing practices along the Yangtze depleted the population, and damming has further adversely affected fish stock; chemical and noise pollution have also made life hard for the baijis. A few years ago, a survey found only 13 individuals, and a preliminary study, the reults of which were released last week, found no signs of these cetaceans. In November this year, a larger study hopes to find some remnant groups... but it looks very likely that the baiji will become the first whale or dolphin to become extinct in the modern era. Various groups are trying to conserve this species, but it seems they may already have lost their porpoise *Hayward gets coat*.

PS, as I was typing last week's AOTW, a couple of hundred yards away London Zoo were preparing to release the news of the virgin birth of four Komodo dragons. Hatched from eggs laid by a female with no male consort for two years, the paternity of these baby dragons remains a mystery. But welcome little Christ-lizards, welcome to Camden!

Animal of the Week April 24, 2006 -- George and the Komodo

2006-04-24T22:24:00.000+01:00

Apologies:
1. For not acknowledging the wonderful source journal Nature for AOTW April 10 (Tiktaalik roseae)
2. For not warning y'all that I'd take Easter Monday off... sorry

Yesterday was the day of St George, England's patron saint, I marked the day by having a lie in, buying some tomato plants, some breadmaking, and listening to folk music on Radio 3. And today I extend the festivities by choosing as the animal of the week the dragon.... er, Varanus komodoensis (Komodo dragon) that is!

The fire-breathing dragon that crusader George slayed held the pagan people of some distant land to ransom by taking up residence in the spring from whence they obtained their water. To get the dragon to move on, the local monarch had to give up his daughter, but just as the dragon was about to eat the princess, valiant George turned up and showed the dragon what for with his lance. Everyone was so glad for what George had done they converted to Christianity.

Komodo dragons can't breath fire, don't much care to hold wells to ransom, and aren't mythical allegories for Satan; however, they can be quite terrifying—weighing over 160 kg and growing to over 3·5 m long they are the largest lizards in the whole world (note, crocodiles, alligators, and turtles are not lizards). These outsize monitor lizards are the top predators on the Indonesian islands of Flores, Rintja, Padar, and Komodo where they eat anything that moves including goats, horses, buffalo, other komodo dragons, and sometimes people. Before people reached these islands wiping out native fauna and bringing in the smorgasbord listed above, Komodo dragons' diets probably comprised giant rats, dwarf elephants, and er, dwarf proto-humans.

Komodo dragons do enjoy carrion, but they are also well-equipped hunters, adept at both ambush and the chase. Their best trick though is having over 50 species of bacteria in their saliva, which means that all they need to do is give a prey animal a little nip and the victim will rapidly be overcome by septicaemia. Lovely!

In this picture a komodo dragon is receiving acupuncture... perhaps the whole George-dragon-lance story is a misunderstanding.

Animal of the Week April 10, 2006 -- Tiktaalik roseae

2006-04-10T15:58:00.000+01:00

Well, I don't know if you've ever sensed that I've been clutching at straws in my selection of animal of the week—some weeks it's tricky. But this week, for choice I have been well and truly spoiled. Now, I could do the dead swan, but I don't see why "Bird flew" is news, you don't hear "Man walked", "Bunny hopped", "Fish swam" making headlines on the Today programme, do you? But "Fish walked", well, that's news isn't it? And because, as a boy I once spent three months in a tiny basement room hunched over a fossilised fish (please don't ask; or do if you'd like, I've still got the slides and would be happy to do a quick presentation), well there was a clear favourite this week: Tiktaalik roseae.

T roseae helps to fill in the gaps between our finned and limbed ancestors. With scales, a fishy mouth, and rayed fins, this inhabitant of a tropical delta in the upper Devonian period (360–385 million years ago) was very much a fish. But with shoulders separated from head by a neck and increasingly bony upper portions to its forelimbs, T roseae was looking a little amphibian about the gills (actually, it didn't even have gills). These adaptations would likely have helped T roseae lift itself above the surface of the water to breath, navigate weed choked channels, and even haul itself between pools should one look to be drying up.

"Missing links" always cause quite a stir. Archaeopteryx, Homo erectus, and Eohippus are some of the most famous found links, but in truth, there are still missing links between T roseae (a fish) and amphibians, between Archaeopteryx (a bird) and reptiles, and so on. Anhyoo, here's to Tiktaalik rosaea and other links yet to be found: the lamprey–fish–shark links, the bird–dinosaur links, my tigers-eye cuff links.

Because I have too much time on my hands, I devised an alternative animal of the week, but fear that you might not have time to digest it all, so I wrote this too (I do have a life honest). Anyway, if you've got the time, the attached is nonsensical drivvel.

Thanks

Peter Hayward
Head Keeper
Animal of the Week

You may have been added to the AOTW mailing list because a friend nominated you, or I felt you would like to receive animal news. If you no longer wish to receive these mails, please reply to this email putting the words "Don't monkey me no more, you fool" in the subject line. Counterclockwise, if you would like to nominate a friend (or enemy) to receive animal pleasure, reply with their address in the body of the email and the words "Monkey this badass, too" in the subject line.

[A benign looking white haired, crinkly faced gentleman waits in the wings as the studio lights are turned down silencing the expectant audience (a mixture of septuagenarians, young couples, and groups of young women who may well be Young Conservatives on hen nights—all sporting the sort of vacant grin that can only be induced by a former yellow-coat warm-up comedian and a free glass of cava laced with Ritalin). The lights go up, the house band strike up the signature tune, the floor assistant holds up a cue card reading "APPLAUSE/CLAP/CHEER". To the sound of the audience obediently 'going wild', our host strides out on stage desperately trying to disguise the arthritic pain in his left knee (he is an 'elder statesman' not an 'old man' of tv). The band ends the signature tune and the applause dies down.]

Parkinson: [A warm yorkshire accent tempered by years of broadcasting] Welcome, welcome, welcome. What a great night we've got for you tonight. Later on in the show we'll be joined by an actress with a list of television credentials seemingly too long for her tender years, Tamsin Outhwaite, who'll be telling us about her new police drama. We're also joined by my favourite comedian, the Big Yin himself, Billy Connolly who'll once again not have anything funny to say but will have a purple beard and make us laugh by shouting. And we've music by great young jazz pianist and singer Jamie Cullum, who will be reinterpreting a classic track by Joy Division. But my first guest is very special, he made headlines across the world this week when discovered on a remote windblasted plain in northern Canada. Please welcome, Tiktaalik roseae.

[House band plays brass-heavy version of Three Little Fishes. A young man wheels out a large tank containing some muddy water, something resembling a cross between a salmon and an alligator can be seen half submerged. Audience applause begins and ends on queue]

Parkinson: Can I just say how marvellous it is to have you here?

Tiktaalik: [Canadian accent] Thank you. It's great to be here, eh.

Parkinson: So, you've been billed the news as a sort of link between fish and limbed animals such as frogs and ourselves, but you’re actually a fish aren't you?

Tiktaalik: Yes, that's right, I'm a fish: scales, fins, a fishy tail [splashes said tail], but I've several characteristics found in limbed animals too. My ears aren't like those of fish, I have a neck, that sort of thing.

Parkinson: Yes, I see, and can I just say I really like your humerus, radius, and ulna; in fact, all your arm bones are really great.

Tiktaalik: Thank you.

Parkinson: But there's something about your forelimb, it's different, and I can't quite put my finger on it [eyes twinkle knowingly, mischievously into the camera]

Tiktaalik: [with a gurgling chuckle] Indeed, and neither can I, eh. I haven't got any. [Audience erupts with appreciative laughter]. I am a fish after all, and contrary to what Captain Birdseye might say, fish don't have fingers. [Studio is in inexplicable hysterics. Somewhere in the audience a Tena lady reaches capacity].

Parkinson: And your hind legs they're not up to much.

Tiktaalik: No, it's going to be a few hundred million years before we get to Shania Twain.

Parkinson: Yes, yes, I suppose so. So, how do all these innovations help you?

Tiktaalik: Well, you see, in the shallow delta pools 375 million years ago near the equator, sometimes it was difficult to breath as water and oxygen levels dropped, and we're in this muddy water looking up at all the air and we're thinking we'd like some of that, eh. So we raise ourselves up on our arms to take a gulp of air. The neck helps us get up there too. These flexible fins are great for moving weeds out of the way too.

Parkinson: Marvellous, marvellous, and what's next for you?

Tiktaalik: Sometimes, if the water level drops a lot, we haul out and drag our piscine selves to some other pool, now we wouldn't be able to do that without these limbs. But we see all these plants and insects, and I'm thinking, the food up here looks pretty good, eh. So, maybe if we would work on these legs, and do something about the end of these fins, someday, my children's children's children's children's children's children can really take advantage of those opportunities.

Parkinson: Well, thank you very much and you will stick around to meet my other guests wont you.

Tiktaalik: For sure.

Parkinson: [To camera] And don't you go anywhere either, after the break we'll be joined by Tamsin Outhwaite, Billy Connolly, and Jamie Cullum. [Band. Applause]

Tiktaalik: [Unfortunately Sound have not killed the fish's microphone] Someone fetch me some earplugs, eh.

Animal of the Week April 03, 2006 -- Cry "Havoc" and let slip the bats of war

2006-04-03T21:15:00.000+01:00

The parts played by animals throughout the history of human conflict have been great and varied, from carrier pigeons and dogs delivering messages in the world wars to Hannibal riding a bunch of elephants over the Alps to attack the Romans in 218 BC (Predictably one member of the Team was absent, as he succinctly put it: I aint gettin' on no goddam pachyderm, fool! [Head Keeper gets coat]).

One of the more surprising attempts involved this week's animal Tadarida brasiliensis (Brazilian free-tailed bat, Mexican free-tailed bat, guano bat). During the second world war, US$2 million was invested in the Bat Bomb. The US Airforce planned to attach incendiary devices to Mexican free-tailed bat and load them into containers that would be parachuted on to Japanese cities. Upon landing, the canister would open and the timers on the incendiary devices would be activated, the bats would then seek out a roost in the wooden eaves of various buildings and 30 minutes later tiny fires would break out throughout the city. The project suffered several setbacks, sometimes bats failed to wake up on landing a simply fried in the container. Most memorably, however, during one test at Carlsbad, New Mexico, incendiary-laden bats escaped and set fire to the Auxiliary Army Air Base. Although the project was passed from the Airforce to the Navy, bats were never deployed in combat and the project was abandoned in 1944 in favour of alternative methods of laying waste to Japanese cities.

These migratory, new world, insect-eating bats live in the largest colonies of any mammal—up to 20 million of them inhabit the most densely populated breeding caves in Texas. The bats are remarkable, flying at heights greater than 10 000 feet (the highest flying bat) and at speeds of over 60 mph. Each year in Texas these bats may consume up to 18 000 tons of insects. These insects are processed into vast amounts of guano, in the early 1900s this excellent organic fertiliser was the Lonestar State's greatest mineral export ahead of oil. [Insert joke about the early 2000s and excrement from Texas]

And I don't do mythical animals, but want to share this with you. If you've got a couple of minutes it is well worth reading for humorous bad Russian-English translation and, well, just and, read it all... http://english.pravda.ru/science/19/94/377/16284_centaur.html

Animal of the Week March 27, 2006 -- Margays

2006-03-27T22:18:00.000+01:00

Ladies and Gentleman, Boys and Girls

This week's animal of the week is Leopardus wiedii (margay, tree ocelot). Early last week, Todd Dalton of Peckham (or Camberwell if you are professional lay-about Guardian columnist Zoe Williams—who is his neighbour and obviously doesn't want to be accused of living in Peckham) in south London was told by Southwark council that he could not house two clouded leopards, two fossas, and two margays in his garden. Now, clouded leopards, you can probably have a guess at (they're beautifully marked, medium sized cats about the size of a small labrador), fossas we visited briefly in AOTW 12/12/05 on the new small carnivore found in Borneo. But margays, what the devil are they?

Like the leopards but not like the fossas, they are cats, small Central and South American felines about the same size as domestic moggies. According to one website, their marbled colouration and large eyes make them, in the opinion of many cat fanciers, the prettiest of all the cats. Certainly these two chaps in the picture are rather endearing. Margays are the only cats to have ankle joints that can rotate through 180 degrees enabling them to climb down trees headfirst like squirrels!

Now, not only have the two margays, two fossas, and two leopards been saved from the ignominy of an SE15 (or SE5, like it matters! [north-London has changed me]) postcode, but given that Todd Dalton seems to be the same man who runs Edible (http://www.edible.com) the company that sells cobra sausages, civet-poo coffee (I kid thee not), and crocodile curry, perhaps they have been saved from a fate more spicy than death?!

The two margays in this week's picture:
Laurence: I like that Zoe Williams, she doesn’t live in Peckham, and we certainly wouldn't live in Peckham!
Jonty: No way will we live in Peckham, let's get one of those penthouses in the new development in Vauxhall.
Laurence: Ooh, Vauxhall, fabulous! And Zoe, Let's all meet up for eggs Florentine in Funky Munky just as soon as we've got a new pad.(For the former and current residents of Camberwell and Peckham, Brixton and Chiswick, and everyone who ever drowned)

Animal of the Week March 20, 2006 -- Caned oats

2006-03-20T21:22:00.000Z

Hello Ani-freaks!

If you've been in the Northern Territory of Australia over the past week you may have found yourself instructed to take up a stout stick and whack this week's animal Bufo marinus (cane toad). These toads are rapidly spreading across Australia to the detriment of much of the continent's wildlife, and state sponsored efforts to raise awareness of the problem culminated in "Not in my backyard day" on March 14, for which residents were encouraged to report sightings of these amphibians. The Federal MP Dave "Practical" Tollner suggested that residents should hit any cane toads they found with "golf clubs, cricket bats, you know, lumps of wood", Australians interviewed seemed keen on this idea. The RSPCA on the other hand recommended the toads should be killed by covering them in haemorrhoid cream (induces a coma apparently) and putting them in the freezer—yeah right, because the concerned citizens really want freezers filled with anusol covered toads!

101 cane toads were introduced to Queensland in 1935 as a biological control of a beetle pest of sugarcane plantations. However, the toads quickly realised that Australia was full of more appealing foods than beetles and they set off, spreading throughout Queensland, Northern Territory, and New South Wales. They are now nearing the outskirts of Darwin and of Sydney. A recent study showed that the toads that had travelled furthest from the 1935 site of introduction had the longest legs. The researchers proposed that this was a sign of evolution in action (a long legged form colonising new lands and a short legged stay at home form), French gourmands proposed a picnic.

Voracious in their feeding habits, cane toads not only pose a threat to the animals small enough for them to eat, sometimes exceeding 2 kg in weight they make an appealing snack for monitor lizards, snakes, and dingoes, but the toxin they secrete through their skin and from two large glands on their shoulders can kill most predators, including crocodiles.

Cane toad males have inactive ovaries, if their testes are injured the ovaries come into action and they become female; moreover, the males can be used as a pregnancy test kit, if you inject them with the urine of a pregnant woman they will produce sperm in their own urine.

Animal of the Week March 13, 2006 -- Hairy lobster

2006-03-13T21:39:00.000Z

Many thanks to everyone who responded to my appeal last week to find out what I had done the previous weekend, I managed to cobble together an erratic journey across London of complicated loops and impossible arcs. When described on a map of this fair city, my drunken ramblings presciently formed a rudimentary sketch of this week's animal, the blind and furry Kiwa hirsuta (hairy lobster [not official]).

As I was looking up this week's animal of the week, I saw the headline "The hairy lobster furmidor" and I thought to myself, that must be The Sun, and lo it was—you may well beat up your husband Rebekah, but, Ms Wade, you and your staff know how to pun. Yes, this week's animal is one of the most bizarre discoveries; not only is Kiwa hirsuta a new species, but it is so distinct from other known crustaceans that a new family within the group has been created for it.

Discovered 1500 kilometres or so south of Easter island, hanging around a hydrothermal vent at 2300 metres below sea level, Kiwa hirsuita is named after the Polynesian god of shellfish—now that's my kind of religion. (I have been trying to find out what the goddess of shellfish did in Polynesian mythology, but the internet is rather taciturn on the matter, if any of you know more I would love to find out.) Scientists remain unsure what the furry cuffs are for, perhaps they are sensory organs to make up for the lack of sight, maybe they help the animal move about. The clusters of setae are riddled with bacteria that may help to detoxify the poisons gushing from the hydrothermal vents or that may even provide food; although, the creature was observed scrapping with crabs for a piece of shrimp, which suggests a rather more refined diet than bacteria, maybe they are where these lobsters keeps the wasabi.

New species are discovered quite frequently (at least four reported in AOTW so far), but a new family, that's something special. I'm sure you all remember the mnemonic King Philip Can Only Find Green Socks, used to help school children remember the major divisions of the Linnaean classification of living organisms (Kingdom, Phylum, Class, Order, Family, Genus, Species), but to get a better idea of what the discovery of a new family means, it's like knowing that horses exist and then discovering rhinoceroses! In the words of Frank Black: That's educational.

While I don't report all new species, I couldn't resist this one simply because I find the phrase "hairy lobster" so funny, it sounds dirty and is almost as good as "Mums' night off bucket" from the new KFC add... someone surely is having a laugh.

Animal of the Week March 06, 2006 -- Bedbug Mountain

2006-03-06T21:29:00.000Z

First off, an appeal:
Lost: Weekend March 3-5 ALSO Dignity

We are looking for information to help locate these items, or at least make reparations for any damages caused in the course of their being lost. The man in the hat and glasses would like to apologise for any emotional hurt, physical injuries, or consternation he may have caused this weekend. Really, he is very very sorry but can't remember what for. We would appreciate your help in uncovering the (we suspect) painful and embarrassing truth. If you had contact with or saw this man over the weekend, please email information, claims for damages, or abuse to animal_oftheweek@yahoo.co.uk.

And the Addermy award (tm) doesn't go to:

Bedbug Mountain -- "I wish I knew how to quilt you" -- Rated R

Terence and Willis, two male Xylocaris maculipennis (bed bugs) find themselves isolated in the bedding of a two young stockherders tending a flock of sheep in early sixties Wyoming. Throughout the course of the summer, starved of the company of female X maculipennis, the insects begin find themselves looking for other diversions. Several species of bedbug use a sperm plug to prevent other males mating with a female after they have; to bypass the plug, this species has developed a needle like member with which to inject their genetic contribution directly into the female's ovaries.

As the tension increases and the flock of sheep diminished, Terence has an idea, creeping up on Willis he uses his syringe-like appendage to inject sperm directly into Willis. Afterwards, he insists "I aint no queer". The summer comes to an end and the two young insects return to their former lives. Eventually, Willis settles down with a female bedbug in a 16 tog duvet in Texas, but he is never quite able to forget that summer on the high midwest pastures and his friend Terence, not least, because the children he fathers all bear a striking resemblance to his former companion, for yes, he has been passing on Terence's sperm all that time.

It really does happen.

Coming soon to a picture house near you:

The career of a country legend in the making is cut short when his offer to exercise one of Tippi Hedren's pets backfires in "Walk the Lion"

The tale of a American wild dog and author researching novel In Cold Blood, the motion picture triumph "Coyote"

The entomologists among you will note that the picture is not of X maculopennis, I couldn't find a picture of this species, instead this picture relates to the appeal at the top of this message. And responds to another reader's suggestion.

Animal of the Week February 27, 2006 -- Riddle me newts

2006-02-27T15:22:00.000Z

Riddle me this, riddle me that (answer at the end of the email):
What connects scumbags, bendy buses, and this week's animal of the week Triturus cristatus (great crested newt)?

Great crested newts are the largest amphibian in the UK and can grow up to 17 cm (7 inches) long. Those of you in the UK will be delighted to know that from early March these warty critters will be re-emerging from their hibernation.

There are three newt species found in the UK, although males of all three may have crests, the great crested newt is the greatest. Males develop a wavy crest along the length of their body and tail in time for breeding from March to May; the females, suitably impressed, mate with the crested males and deposit individual eggs on aquatic plants in the breeding ponds (they do not lay clumps of spawn like frogs).
Great crested newts are endangered and touching or capturing them is prohibited and disturbing their habitat is illegal. So, if you are lucky enough to encounter this magnificent beast, look but do not touch. One reader who once built a road was entrusted with securing the future of newts on The Isle of Grain by monitoring the newt fence that stopped great crested newts entering the building site.

The word newt is derived from the middle English "eft", "eft" became "ewt" and "an ewt" became "a newt". The reverse happened to the word "apron", which used to be "napron" but "a napron" (meaning small tablecloth and etymologically related to "napkin") became "an apron".

Newts secrete noxious chemicals to deter predators. In the attached pictures you will note the cold reptillian gaze and slimy countenance.

Answer to the riddle:
Ken Livingstone
London's mayor referred to the staff of the Evening Standard as "scumbags and bigots" in the volley of insults levelled at Oliver Finegold last February which has led to his imminent suspension, mayor Ken introduced bendy buses to the capitol's roads and he breeds newts.

Animal of the Week February 13, 2006 -- Freddy, Julia, and the Manatees

2006-02-13T15:30:00.000Z

Yeah! Spring break! Me and Julia Stiles and Freddie Prinze Jr are heading off to Florida to drink sugary cocktails and spew on old people. Then we're going to find an ugly girl-boffin, take off her glasses, and cut her hair so that she is suddenly beautiful, and the school jock (Freddie) is going to fall in love with her while Julia is going to wave her hands in the air in her trademark way. Well, that's not going to happen, but if any film producers are reading this, you've got my email. But I am going to Florida, and by this time next week (when because I am on spring break there won't be an AOTW) I hope to have seen this week's animal Trichechus manatus (West Indian manatee).

Manatees are ace -- there are three species, the Amazonian, the West African, and the West Indian. Along with their relatives dugongs, manatees are the only living mammals in the group sirenia, their next closest living relatives are, perhaps rather surprisingly, elephants! West Indian manatees live in marine and fresh water around the Caribbean and gulf of Mexico. Growing upto 4.5 m in length and weighing up to 1500 kg, manatees are impressive animals. Lounging around in shallow waters they graze on water grasses and other plants. Their coarse diet wears their teeth down, and, like elephants, teeth are replaced throughout their life.

Desipte belonging to the order sirenia, a name that suggests some form of tantalising maidenlike appearence, manatees are not generally considered to be the most handsome of animals. However, there is a theory that manatees and dugongs hanging around harbours were the origins of mermaid myths; again like elephants, they suckle their young at teats near their forelimbs rather than on their bellies, so perhaps this human-like trait helped.

I'll be back with you in a couple of weeks, until then, play safe.

Thanks for continued feedback, the innovation of what I like to call paragraphs resulted from the constructive comment of one reader. If you'd like to see any changes let me know.