Animal of the Week -- May 14, 2007

And let it be known that May 2007 was the month of marsupials. For this week's animal of the week is Monodelphis domesticus (grey short-tailed opossum, or grijze of gewone kortstaartopossum for my Dutch readers).

Hopping continents from last week's Australasian representative of the marsupials, this wee mouse-like marsupial hails from the forests of Brazil and Bolivia. Arboreal in habit and unremarkable in many respects, the grey short-tailed opossum is most notable for being the first marsupial to have its genome sequenced (published in the journal Nature [I have obligations]). A popular laboratory animal, scientists hope that knowledge of its genetic make up will provide insights into how its babies, which are born at about the same developmental stage as a 40 day old human foetus, manage to survive simply clinging to the teat of their mother without an immune system and how the young repair their spinal cords if they are severed. Comparison between this genome and that of other sequenced mammals, such as human beings, chimpanzees, and mice will reveal some of the major differences evolved since the divergence of marsupials and the rest of us some 180 million years ago.

Given that the word marsupial is derived from marsupium, it seems a damn cheek that these animals don't have a pouch -- the young simply hang from their mothers' teats. The word opossum comes from the native-American Algonquian word "wapathemwa" for the Virginia opossum. The word the comes from the word.

And for the DNA freaks amongst you here's a joke:

ACGAAATTTATGGGCACACGGGGCGCAATTGGTTTGGCCCAAACCACACATTTGT
TTCTCCCGAGTCCCGAGATCACATTCGAGCCTCTCACTACTAGCAGACGACGACT
ACATATACT

ORF ORF!