Animal of the Week -- May 28, 2007

Sorry, sorry, sorry.

Animal of the Week? Animal of the Fortnight more like!

Still, just time for one more marsupial for May. And this week's is a weird but beautiful creature. It's Notoryctes typhlops (southern marsupial mole)!

Like moles of the northern hemisphere and the golden moles of Africa, marsupial moles are extremely highly adapted to a burrowing (or fossorial, to use the technical language) lifestyle. Like the others they have big shovel-like claws on their front legs, hard nose, fused neck vertebrae, and they are blind because where their eyes should be, there is merely skin and lovely cream coloured velvety fur.

Living in desert environments, these moles swim through the sand searching for worms, witchetty grubs (http://animal-of-the-week.blogspot.com/2006/11/animal-of-week-november-13-2006.html), other larvae, and the occasional lizard. Another cunning adaptation to the fossorial lifestyle, this marsupial's pouch (or marsupium, to use the technical language) points backwards.

Once, the two species of marsupial mole were thought to be monotremes related to the platypus and echidna, not marsupials at all. Until recently their incredibly specialised form confounded taxonomists who were unable to work out how they were related to other marsupials. But actually these moles are most closely related to carnivorous marsupials such as numbats, Tasmanian devils, quolls, and the recently extinct Tasmanian tiger.

So anyway, this is the marsupial mole, it is animal of the week, and I am off now.

Byeee!

Animal of the Week -- May 14, 2007

And let it be known that May 2007 was the month of marsupials. For this week's animal of the week is Monodelphis domesticus (grey short-tailed opossum, or grijze of gewone kortstaartopossum for my Dutch readers).

Hopping continents from last week's Australasian representative of the marsupials, this wee mouse-like marsupial hails from the forests of Brazil and Bolivia. Arboreal in habit and unremarkable in many respects, the grey short-tailed opossum is most notable for being the first marsupial to have its genome sequenced (published in the journal Nature [I have obligations]). A popular laboratory animal, scientists hope that knowledge of its genetic make up will provide insights into how its babies, which are born at about the same developmental stage as a 40 day old human foetus, manage to survive simply clinging to the teat of their mother without an immune system and how the young repair their spinal cords if they are severed. Comparison between this genome and that of other sequenced mammals, such as human beings, chimpanzees, and mice will reveal some of the major differences evolved since the divergence of marsupials and the rest of us some 180 million years ago.

Given that the word marsupial is derived from marsupium, it seems a damn cheek that these animals don't have a pouch -- the young simply hang from their mothers' teats. The word opossum comes from the native-American Algonquian word "wapathemwa" for the Virginia opossum. The word the comes from the word.

And for the DNA freaks amongst you here's a joke:

ACGAAATTTATGGGCACACGGGGCGCAATTGGTTTGGCCCAAACCACACATTTGT
TTCTCCCGAGTCCCGAGATCACATTCGAGCCTCTCACTACTAGCAGACGACGACT
ACATATACT

ORF ORF!

Animal of the Week -- May 7, 2007

Although Andrew Motion was quaking in his boots when he first saw last week's effort, he was quickly relieved when he spotted my egregious error in suggesting that the people conned in the poodle scam had been given back their mediaeval instrument rather than their "loot". I would like to say that I spotted the error myself, but if I told you that I would be a lyre.

Crashing on, this week's animal of the week is Dendrolagus mbaiso (dingiso, bondegezou). This cute little bundle of loveliness is a tree kangaroo from the Western New Guinea region of Indonesia. I always found it bizarre that a kangaroo should climb a tree, but dingisos are doubly weird as their ancestors came back down from the trees and they are largely terrestrial, spending little if any time in trees. Such evolutionary wrong-headedness would typically make the kangaroos an easy target for human hunters. Fortunately, the local Moni people regard dingisos as ancestors and do not hunt them, even though the kangaroos can be coaxed from a tree with a handful of succulent leaves and a noose easily slipped around their neck. When they encounter human beings, dingisos wave their arms in the air and whistle like pie-eyed new-rave devotees in New Cross, and the Moni view this as a greeting from their ancestors. Sounds like a partnership made in heaven for the Moni and the dingisos.

Evolving in a land without other mammals, tree kangaroos fill the niches generally taken by monkeys. And their commitment to this must be viewed with some respect. Fitting huge hind legs developed for bounding across open plains up a tree is not easy. Dingisos have, however, readapted to life on the ground, whereas other tree kangaroos have shorter hind legs and very long tails, the reverse is true of these lovely black and white fellows. Their striking pied fur is very dense, an adaptation to their life at high altitudes where the temperature can drop to below zero most nights. I salute these weird critters: the black and white, new rave, ground-tree kangaroos.